ID: 1087876285

View in Genome Browser
Species Human (GRCh38)
Location 11:103361919-103361941
Sequence CTGGATATTCAGAATAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087876281_1087876285 24 Left 1087876281 11:103361872-103361894 CCGAATAGCTTCTGAGAGGTTAA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1087876285 11:103361919-103361941 CTGGATATTCAGAATAAAAGTGG 0: 1
1: 0
2: 1
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087876285 Original CRISPR CTGGATATTCAGAATAAAAG TGG Intronic
902072973 1:13757085-13757107 CTTGGTATTTAGAATTAAAGTGG - Intronic
902765955 1:18615395-18615417 CTGGAAATTCAGAACAGAATAGG + Intergenic
906447180 1:45912127-45912149 CTGGGGATTCTGAAAAAAAGAGG + Intronic
907345739 1:53778143-53778165 CTGAATATTCAGATTAAGTGGGG - Intronic
908000948 1:59678342-59678364 CAAGATATTCAGAATTACAGAGG - Intronic
909150712 1:72000811-72000833 CTAGATAGTCAAAATGAAAGAGG + Intronic
911394960 1:97293996-97294018 CTGAATATTAAGAATAAAATGGG + Intronic
911416032 1:97575590-97575612 CTTGATTTTCATAATAAAAAGGG - Intronic
911488390 1:98530986-98531008 GTCGATATTCTGAATAAATGTGG - Intergenic
911779158 1:101853681-101853703 CTGTATATTCACACTAAAAATGG - Intronic
912198169 1:107424402-107424424 CATCTTATTCAGAATAAAAGAGG - Intronic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
914320315 1:146552790-146552812 CTGTATATTGACACTAAAAGTGG - Intergenic
915019559 1:152766192-152766214 CTGGATATTCATTATAGAAATGG - Intronic
916494940 1:165338267-165338289 CTGGCTATTCAGAGAGAAAGAGG - Intronic
916955778 1:169833115-169833137 CTAGCTCTTCAAAATAAAAGGGG - Intronic
917711726 1:177692140-177692162 CTAGAGTTTCAGAATAAGAGGGG + Intergenic
918360719 1:183754580-183754602 CTGGCAATTCACAAAAAAAGAGG + Intronic
919172330 1:193970851-193970873 AGGGATATTCAGGAGAAAAGAGG + Intergenic
919319844 1:196021734-196021756 GTAGATAGTCAGAATAAAAGAGG - Intergenic
921483107 1:215686298-215686320 CTTGTTATTCAGAAGAAAGGGGG + Intronic
922486163 1:225974819-225974841 CTGGAAATTCAGAGAAAAAGTGG - Intergenic
923966000 1:239140017-239140039 CAGGATATTCTCAATAAAACTGG + Intergenic
924726812 1:246678867-246678889 CTGGATATTCAAAGAATAAGAGG - Intergenic
1063753296 10:8976763-8976785 CTAGATATGCAGAGTAAGAGTGG + Intergenic
1063810012 10:9694015-9694037 ATGGATTTTCAGAAGAAAGGGGG - Intergenic
1065287948 10:24203223-24203245 ATGGAAATGAAGAATAAAAGGGG - Intronic
1066435997 10:35397175-35397197 CTTTGTATTCAGAAGAAAAGTGG + Intronic
1066473365 10:35720830-35720852 ATGGAAATTGAGAATGAAAGAGG - Intergenic
1066497676 10:35958107-35958129 CTAGAAATTCTGAATTAAAGAGG - Intergenic
1066527657 10:36298485-36298507 CTAAATATTCAGAATTAAACTGG - Intergenic
1067975710 10:51022727-51022749 TTTGTTATTCAGAGTAAAAGTGG - Intronic
1068145690 10:53067666-53067688 CAGGTTATTCATTATAAAAGTGG + Intergenic
1068173885 10:53431165-53431187 CTGGATATACATAGTAATAGAGG + Intergenic
1068200090 10:53773225-53773247 CAGGTTATTCAGAATCAAATTGG - Intergenic
1068431841 10:56943117-56943139 CTGGAAATTCAGAAATGAAGAGG - Intergenic
1069115889 10:64506228-64506250 CGGTAAATTCAGAATAAAAGAGG + Intergenic
1069187056 10:65437023-65437045 TTTGACAGTCAGAATAAAAGTGG + Intergenic
1070618592 10:77988745-77988767 CTATATATTCAGTATAAGAGGGG + Intronic
1072223621 10:93348319-93348341 CTGGAAATTCAGTGTAAAAATGG + Intronic
1073417412 10:103396035-103396057 ATGGACATACAGAAGAAAAGAGG + Intronic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1076370165 10:129947617-129947639 CTTTATATTCAGAATTTAAGTGG - Intronic
1078489052 11:11752463-11752485 CAGGAAAGTCACAATAAAAGGGG - Intergenic
1078502942 11:11901012-11901034 CTGGGGATTGAGAATAGAAGAGG + Intronic
1079170271 11:18087212-18087234 CTGGATTTTCAGAACTAAATAGG + Exonic
1080187887 11:29512453-29512475 CTGAGTACTTAGAATAAAAGAGG - Intergenic
1080879310 11:36304223-36304245 ATGGATCTGCAGAATAAAATGGG + Intronic
1081597931 11:44472056-44472078 CTAGTTATTAACAATAAAAGGGG - Intergenic
1083100736 11:60303170-60303192 CTAGATGTTGAGGATAAAAGTGG - Intronic
1083434479 11:62633268-62633290 CTGGCTGTTAAGAAGAAAAGAGG + Exonic
1085016051 11:73174702-73174724 CTGGATAATCAGAACCAAAGGGG + Intergenic
1087876285 11:103361919-103361941 CTGGATATTCAGAATAAAAGTGG + Intronic
1088426063 11:109704791-109704813 CTGTATATTTAGAAAAAAAATGG - Intergenic
1088472520 11:110201608-110201630 CTGGATATTCACAACACAGGAGG + Intronic
1088581080 11:111317609-111317631 CTGGATAATCAGGAAGAAAGAGG + Intergenic
1088717628 11:112562702-112562724 CTGGGTATTCATAAGAAAAGAGG - Intergenic
1088758854 11:112910416-112910438 TTGGACATTCTGAATGAAAGGGG - Intergenic
1089026828 11:115279423-115279445 TTGGATATTCAGGAGAAAATTGG - Intronic
1090453986 11:126831461-126831483 ATGGCTATTCAAAAGAAAAGTGG - Intronic
1091176903 11:133567196-133567218 CTGGATATACAAAAAAAAATAGG + Intergenic
1092574827 12:9770314-9770336 ATGCACATTCAGAAAAAAAGGGG + Intergenic
1093392853 12:18644026-18644048 CTGGATATTAAGGAGAAAGGAGG - Intronic
1094879575 12:34704253-34704275 TTGGAAATTCAAAAAAAAAGAGG - Intergenic
1095254665 12:40020452-40020474 CAGGAAATTCAGAATCATAGTGG - Intronic
1095335732 12:41023414-41023436 CTGGGTATTAAGATTGAAAGTGG - Intronic
1096944874 12:55392797-55392819 CTCAAAATTCAGAATAAAAAGGG + Intergenic
1097842117 12:64331862-64331884 CTGGAAAGACAGAATAACAGCGG - Intronic
1098020038 12:66145180-66145202 CTGGATTACCAGAATAAAAGGGG + Intronic
1100001191 12:89837327-89837349 TTGGAAGTTTAGAATAAAAGAGG - Intergenic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1105775546 13:23656514-23656536 CTGGATATTCAGAAAAATCCTGG - Intronic
1106682183 13:32019299-32019321 CTGGGTGTCCAGAAAAAAAGTGG - Intergenic
1108628983 13:52262224-52262246 CTGGATACTCTGATTAAAAATGG + Intergenic
1109908140 13:68872923-68872945 CAGGAAATTCAGAGTCAAAGAGG - Intergenic
1110087921 13:71405667-71405689 GTGCATATAAAGAATAAAAGAGG - Intergenic
1110670482 13:78171193-78171215 CTGGAATTTCAGAATAAAGGTGG + Intergenic
1110685707 13:78371483-78371505 CTGGCTATTCAGAATTGAGGAGG - Intergenic
1110769440 13:79322170-79322192 CTGGATAATGAGAAGAAATGTGG - Intronic
1111418717 13:87981460-87981482 CTGCATTTTCAGAATAAGAATGG + Intergenic
1111805553 13:93036889-93036911 CTGGATGTTTAGAATAAAAAAGG - Intergenic
1111834941 13:93376291-93376313 ATGGATATTGTGAATAAAAGAGG - Intronic
1111949325 13:94698265-94698287 CTGTCTCTACAGAATAAAAGAGG - Intergenic
1112294301 13:98173085-98173107 CTGGGTATGTAGAATAAAAAAGG + Intronic
1112965126 13:105181047-105181069 GTGAATATTCAATATAAAAGTGG + Intergenic
1113033926 13:106027398-106027420 CTTGATATTAAAAATAAAATTGG - Intergenic
1114058361 14:18996151-18996173 ATGCATATTAAGAATAAAACTGG - Intronic
1114104185 14:19405603-19405625 ATGCATATTAAGAATAAAACTGG + Intronic
1114854308 14:26419574-26419596 TTGGAGATTCATAACAAAAGAGG - Intergenic
1115791384 14:36882788-36882810 CTAGATATTCAGTCTAAAACTGG + Intronic
1116252791 14:42508107-42508129 CTGGCTATGCTGAATAAGAGTGG - Intergenic
1116326979 14:43542167-43542189 CTGAAAATTCACAATAAAACAGG - Intergenic
1116878105 14:50134636-50134658 TTTGATAATCAGAAAAAAAGTGG + Intronic
1117267554 14:54105670-54105692 CTGAATTTTCAGAAAAAAAAAGG - Intergenic
1119395004 14:74319795-74319817 CTGTAGATTGAGAAGAAAAGAGG + Intronic
1119496415 14:75083563-75083585 CTAGACATTCAGAAAGAAAGTGG + Exonic
1119612410 14:76074789-76074811 CTGGATCTTCAGCAAAGAAGGGG - Intronic
1120747535 14:88165734-88165756 CTGGATAATTACAATAAAAGGGG - Intergenic
1120816880 14:88870154-88870176 CTGGCTGATCAGAATAGAAGTGG - Exonic
1122015445 14:98791294-98791316 CTGGATACTGAGGATACAAGTGG + Intergenic
1124552821 15:30697085-30697107 ATTTATATTCAGAATCAAAGAGG - Intronic
1124678421 15:31708585-31708607 ATTTATATTCAGAATCAAAGAGG + Intronic
1126231163 15:46326751-46326773 CTGGAAATTAAGGATAAAATGGG - Intergenic
1127681306 15:61301244-61301266 CTGGAGTTTCGGAAGAAAAGTGG + Intergenic
1128200885 15:65806776-65806798 ATGGAGATTAAGAATCAAAGAGG - Intronic
1129234071 15:74213451-74213473 CTTGAAACTCAGCATAAAAGTGG + Intergenic
1129586455 15:76871980-76872002 TTGAATATTAAAAATAAAAGAGG + Intronic
1130006094 15:80099921-80099943 ATGGATATTCATAATGAAAGTGG + Intronic
1130024768 15:80261603-80261625 CTGGATAATTACAAAAAAAGAGG - Intergenic
1130151377 15:81314327-81314349 CTGGAAGTCCAGAATCAAAGGGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1131672756 15:94637441-94637463 CTGGATATTTAAAATAGAACTGG - Intergenic
1133991489 16:10710826-10710848 CTGGATATTAAGAACAATATCGG + Intergenic
1137866713 16:51905088-51905110 TTTTATATTCAGAATAAAAATGG - Intergenic
1138002423 16:53295646-53295668 CTGGGTAATAAGAATAAAAATGG - Intronic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138511179 16:57509306-57509328 CTGGATCCTCAGCATAAAATAGG + Intergenic
1139086371 16:63591489-63591511 ATGAATATTCAGAATAAAAATGG + Intergenic
1140013218 16:71157316-71157338 CTGTATATTGACACTAAAAGTGG + Intronic
1142370587 16:89678390-89678412 AGGGATGTTCAGAATAAAACAGG + Intergenic
1143677517 17:8446446-8446468 CTGGATTTTCAGGCTAAATGCGG - Intronic
1144612243 17:16730994-16731016 GTGCATATTTAGAATAAAACTGG - Intronic
1144900487 17:18584303-18584325 GTGCATATTTAGAATAAAACTGG + Intergenic
1145131959 17:20361382-20361404 GTGCATATTTAGAATAAAACTGG - Intergenic
1146511349 17:33451659-33451681 CTAGTTATTCTGAATAAAAGTGG - Intronic
1149008180 17:51827249-51827271 CTGCAGATTGAAAATAAAAGGGG - Intronic
1150597631 17:66620372-66620394 CTGGGTAGGCAGAAGAAAAGGGG + Intronic
1153536987 18:6112647-6112669 CTGGAGATTCAGACAAAAATTGG - Intronic
1153903412 18:9638798-9638820 ATGGTTATCTAGAATAAAAGTGG - Intergenic
1154179730 18:12123352-12123374 CTGCATATTAAGAGTAAAACTGG - Intronic
1156201655 18:34839527-34839549 CTTGATATTAATAATAAATGTGG + Intronic
1157718305 18:49904621-49904643 CTGCAGATTCAGAACTAAAGTGG - Intronic
1159399453 18:67911709-67911731 CTGGGTATTTATAAGAAAAGAGG - Intergenic
1162905226 19:13819165-13819187 CTGGGTAATCCAAATAAAAGAGG - Intronic
1163299718 19:16436583-16436605 TTGGTTATTCAGAATAGAAGAGG - Intronic
1163734370 19:18970082-18970104 TTTGGTATTCAAAATAAAAGAGG + Intergenic
1164667769 19:30052751-30052773 CTGGATACTCAGAAAAGAAAGGG + Intergenic
1165565438 19:36723282-36723304 CTGGAAATGCAAAATCAAAGGGG - Intronic
1166104993 19:40593571-40593593 CAGGATATTCAGAATATTGGGGG + Intronic
1166244545 19:41516195-41516217 CTGGATATTAGGAACCAAAGGGG + Intergenic
929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG + Intergenic
930587804 2:53290074-53290096 CTGTGTATGCAGCATAAAAGAGG + Intergenic
930617560 2:53609258-53609280 CTGGAAATTTAGCCTAAAAGAGG + Intronic
932884138 2:75532663-75532685 CTGGAGCTCCAGAATGAAAGAGG + Intronic
933502179 2:83127185-83127207 CTGTAAATTCAGAATGAAACTGG - Intergenic
934545068 2:95207647-95207669 CCGGACACTCAGATTAAAAGGGG - Exonic
934626366 2:95859013-95859035 CTACATATTAAGAATAAAACTGG + Intronic
934807195 2:97242311-97242333 CTGCATATTAAGAATAAAACTGG - Intronic
934830311 2:97514876-97514898 CTGCATATTAAGAATAAAACTGG + Intronic
935957324 2:108390330-108390352 CTGGTTATTCAGAAATAAATAGG - Intergenic
937077585 2:119118141-119118163 CTGGATGTTCAGTAGCAAAGGGG - Intergenic
937685831 2:124696047-124696069 TTGAATCTTCAGGATAAAAGAGG - Intronic
938046132 2:128122358-128122380 TTGTATATTCAGTAGAAAAGCGG - Intronic
938282844 2:130078066-130078088 ATGCATATTAAGAATAAAACTGG + Intronic
938432769 2:131260839-131260861 ATGCATATTAAGAATAAAACTGG - Intronic
938476774 2:131623093-131623115 ATGCATATTAAGAATAAAACTGG - Intergenic
938706951 2:133940129-133940151 CTGGAGATACAGAATTGAAGAGG - Intergenic
939775800 2:146386213-146386235 CTGGATCAGCAGAATAAATGTGG - Intergenic
940304313 2:152209200-152209222 CTGGATATTAAGAATCAGACCGG + Intergenic
940410530 2:153358535-153358557 CAGGTTAGTAAGAATAAAAGGGG - Intergenic
940545737 2:155082163-155082185 CTGGATTTACAGCATGAAAGGGG - Intergenic
941137810 2:161739221-161739243 CTGGTTAATCTGGATAAAAGAGG - Intronic
941608076 2:167625102-167625124 CTGGAACTTCAGAAAAAAATTGG + Intergenic
941960518 2:171248869-171248891 GTGGATATTCAAAATGAAGGCGG - Intergenic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
945223587 2:207509101-207509123 CTTCATATTCAGATTAAATGTGG - Intergenic
945393915 2:209298898-209298920 CTGGTTGTTAAGAATAAAGGAGG - Intergenic
946436422 2:219659154-219659176 CTGAATATTAAGAATAAATGAGG + Intergenic
946469506 2:219945330-219945352 CTGGATATGCTGAAGAAAAATGG + Intergenic
1169875472 20:10292625-10292647 CTGGACACTCAGAATCAAACAGG + Intronic
1170915662 20:20622252-20622274 CTGGAGATGCAGAAAAAAACAGG + Intronic
1175406003 20:58729098-58729120 CTGTATATTCAGCGTTAAAGAGG + Intergenic
1175601982 20:60281678-60281700 CTGGATGTTCAGAGGAAATGAGG + Intergenic
1176662577 21:9652635-9652657 CTGGATTTTCAGAAATAAAAAGG + Intergenic
1176884131 21:14233825-14233847 CTGACTATACAGAATAAAGGAGG + Intergenic
1177391859 21:20485693-20485715 CTTGAAAATCAGAACAAAAGTGG + Intergenic
1177501250 21:21958782-21958804 CTCGATATTCAAAATAATATTGG + Intergenic
1177756104 21:25350096-25350118 CTGGATATTTATACTTAAAGAGG + Intergenic
1177984259 21:27953703-27953725 CAGAATAGTGAGAATAAAAGTGG + Intergenic
1178261076 21:31100245-31100267 CTGGTAATTTATAATAAAAGAGG + Intergenic
1178617086 21:34143961-34143983 CAGGAAATTCCGAATAAAACAGG - Intergenic
1180476849 22:15718770-15718792 ATGCATATTAAGAATAAAACTGG - Intronic
1180566972 22:16678434-16678456 CTGCATATTAAGAGTAAAACTGG + Intergenic
1181095122 22:20499688-20499710 CTGTATCTTAAAAATAAAAGAGG - Intronic
952553172 3:34501951-34501973 CTGGCTATGAAGAAGAAAAGGGG + Intergenic
952998631 3:38909450-38909472 CTGCATTTTTAAAATAAAAGTGG + Intronic
953192813 3:40704325-40704347 CAGGAAACTAAGAATAAAAGGGG - Intergenic
954164904 3:48748944-48748966 CTGGAGCTTAAGAAGAAAAGAGG + Exonic
954271212 3:49510826-49510848 CTGGATATAAAGCATAAATGAGG + Intronic
954717967 3:52536306-52536328 CTGGGTATTAGGAATAAAAATGG + Intronic
956630951 3:71316110-71316132 CTGGATCTGCAGAAGAGAAGGGG - Intronic
958072130 3:88627785-88627807 TTATATATTCAGAAAAAAAGTGG - Intergenic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
959749818 3:109820241-109820263 CTGCATGTTCAAAATAGAAGAGG + Intergenic
959916382 3:111821099-111821121 CTGGATACTCAGAATCACTGGGG - Intronic
960311286 3:116119581-116119603 CTGGACATTCAGCACAAAAATGG + Intronic
960413455 3:117356361-117356383 CTTGGAATTCAGAGTAAAAGCGG - Intergenic
960452998 3:117833116-117833138 CTTGCTATCCAGAATAAAGGTGG + Intergenic
961231498 3:125316027-125316049 ATGGATATAGAGAGTAAAAGGGG - Intronic
962403881 3:135083779-135083801 CTGCATATTAAAAATAATAGAGG + Intronic
963751662 3:149186205-149186227 CTGGAAAATCAGACTAGAAGGGG - Intronic
964238741 3:154566208-154566230 GTGGAAATAAAGAATAAAAGAGG + Intergenic
966169774 3:177066376-177066398 CTTGGTATTCAGACTAAAGGAGG + Intronic
967888633 3:194349495-194349517 CTCAATATTTAGAATAAAATAGG - Intronic
968388925 4:172184-172206 TTGTTTATTCAGAAAAAAAGAGG - Intergenic
971530259 4:27678896-27678918 CTTGATATTCAGAATAACTCAGG - Intergenic
971885722 4:32445019-32445041 CTAGATATTGGGAATAAAAATGG - Intergenic
972314304 4:37911575-37911597 ATGCATGGTCAGAATAAAAGCGG - Intronic
972810471 4:42580489-42580511 CTGGCTATAAAGAATAACAGAGG + Intronic
973264519 4:48198140-48198162 CTGGTTCTTCAGATGAAAAGTGG - Intronic
973992515 4:56424254-56424276 CTAGATACTCAGAATCCAAGGGG - Intronic
974861041 4:67522051-67522073 CTGTATACTCAGAAATAAAGTGG + Intronic
975079504 4:70259209-70259231 CAGGATATTGATAATAAAGGAGG + Intergenic
976010508 4:80482043-80482065 CTGGATAGTAATAAAAAAAGTGG + Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
982246480 4:153357185-153357207 ATGTATACTCATAATAAAAGAGG - Intronic
982444956 4:155479437-155479459 ATGGAAATTCAGTATCAAAGAGG + Intergenic
982465854 4:155731010-155731032 CAAAGTATTCAGAATAAAAGAGG + Exonic
982953986 4:161739370-161739392 CTAGAAATTCAAAATAAAGGTGG - Intronic
983287197 4:165754757-165754779 CTGGATATTAAAAACTAAAGAGG + Intergenic
983902417 4:173149947-173149969 TTGCATATTTTGAATAAAAGCGG + Intergenic
984532992 4:180940512-180940534 GTAGATGTTCTGAATAAAAGAGG - Intergenic
985412819 4:189703890-189703912 CTGGATTTTCAGAAATAAAAAGG - Intergenic
987445503 5:18013470-18013492 CTGGCTATTCAAAAGGAAAGGGG + Intergenic
988771552 5:34437963-34437985 GTGATTATTCAGAATAAGAGCGG - Intergenic
989408078 5:41083941-41083963 CTAGATATGCCTAATAAAAGAGG - Intergenic
989708464 5:44367237-44367259 CAGGAGTTTCAAAATAAAAGTGG + Intronic
990530317 5:56667006-56667028 CTGGATATTCTGAAGTACAGAGG - Intergenic
990664573 5:58057329-58057351 TTGGATATTCAGAATAAAATTGG - Intergenic
991372149 5:65930229-65930251 GGGGATATTCAGAATTAAATGGG - Intronic
991482061 5:67091006-67091028 CTGAATATTCAGGATAAACTCGG + Intronic
991530935 5:67613348-67613370 CTTGATATTCAAAAGAAATGAGG - Intergenic
997094166 5:130891844-130891866 CAAGAGATTAAGAATAAAAGAGG - Intergenic
997681403 5:135754957-135754979 CTGGATATTATAAATAGAAGAGG - Intergenic
997910838 5:137871480-137871502 GTGGATATTCAGGATTAGAGGGG - Intronic
1000116770 5:158161032-158161054 CTGAATGTTCAGAATTAAAAAGG - Intergenic
1000541273 5:162542869-162542891 CTGGATATTTAGAAGAGAAAGGG + Intergenic
1003203760 6:3988640-3988662 AAGGATATTCAGAAGTAAAGGGG + Intergenic
1003723830 6:8736374-8736396 GGGGATATTAAGAATCAAAGAGG - Intergenic
1003895249 6:10601393-10601415 ATGTGTTTTCAGAATAAAAGTGG - Intronic
1005403315 6:25458260-25458282 TTTGATGTTCAGAAAAAAAGAGG + Intronic
1005608950 6:27504817-27504839 GAGGAAACTCAGAATAAAAGTGG + Intergenic
1006257852 6:32845218-32845240 CTTGATATTTATAATAAAATTGG - Exonic
1008799579 6:55349926-55349948 CTTGATATTCAAAATTAATGTGG - Intronic
1010067235 6:71697563-71697585 ATTAATATTCAGAATAGAAGAGG - Intergenic
1010890020 6:81295417-81295439 CTTAATCATCAGAATAAAAGTGG - Intergenic
1011193325 6:84757181-84757203 TGGAATATTCAGAAGAAAAGTGG - Intronic
1012042632 6:94229199-94229221 CTAACTATTCTGAATAAAAGAGG - Intergenic
1012367613 6:98461416-98461438 CAGGATGAACAGAATAAAAGAGG + Intergenic
1013193196 6:107821528-107821550 CATGATAATCAGATTAAAAGAGG + Intronic
1013444840 6:110214068-110214090 ATGGATATTAACAATAAAAAAGG + Intronic
1014106961 6:117575981-117576003 CTCAATATCCAGAATAAAAAGGG - Intronic
1014305628 6:119737829-119737851 CTAAATATTTAGAATGAAAGTGG - Intergenic
1015722129 6:136253520-136253542 TTGGAAATTTTGAATAAAAGTGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017340686 6:153318177-153318199 CATGATATTCAGAAGAAAACAGG + Intergenic
1018017240 6:159723640-159723662 CTGGACTTTCAGATTAAAACTGG - Intronic
1018568034 6:165177918-165177940 CTGGATTTTCGGATTAAAAGTGG - Intergenic
1022618612 7:31958481-31958503 CTGGATATTCAGATTGCAAAAGG - Intronic
1022870869 7:34478354-34478376 CTGGATGTAAAGTATAAAAGTGG + Intergenic
1023354918 7:39357006-39357028 CTTGCTATTCAGAATATAATAGG + Intronic
1024801135 7:53080750-53080772 ATTGATATTAAGAATGAAAGAGG + Intergenic
1026405328 7:70059573-70059595 CTGGAAATTCTGTATGAAAGAGG + Intronic
1026555475 7:71404989-71405011 CTGCAGATTCAGAAGAAAATGGG + Intronic
1027811328 7:82903915-82903937 CTGGATATTAAAAACAAAACAGG + Intronic
1028222942 7:88218681-88218703 CTGAATGTTCAGAATAAATGAGG - Intronic
1028736068 7:94213826-94213848 CTTGATTTTCAGAGTAAATGGGG - Intergenic
1029977223 7:104846213-104846235 CTGGATTTACAGAATAAATTGGG + Intronic
1031363354 7:120874076-120874098 CTGGATTTAGAGAATAAATGGGG + Intergenic
1031496729 7:122458440-122458462 CTGGATATTTAAAATTAGAGGGG - Intronic
1031501935 7:122528989-122529011 CTTGGTATTAATAATAAAAGTGG - Intronic
1032553933 7:132812113-132812135 ATGGATATTGGGAATGAAAGGGG - Intronic
1032670635 7:134079498-134079520 ATGGTTAATCAGCATAAAAGGGG - Intergenic
1033203918 7:139400030-139400052 TTGGATATTCAGAAGACAAGAGG - Intronic
1037181251 8:16007934-16007956 GTGTATATTCAGAATAAAATGGG + Intergenic
1038223775 8:25635753-25635775 CAGGATGATCAGAATTAAAGTGG - Intergenic
1040087435 8:43360053-43360075 ATGCATATTAAGAATAAAACTGG - Intergenic
1040405066 8:47092894-47092916 ATGAATATTAAGAATAAAACTGG + Intergenic
1041819205 8:62010434-62010456 CGGCATATTCAAAACAAAAGTGG - Intergenic
1042082866 8:65074976-65074998 CTGTTTATTCATATTAAAAGGGG - Intergenic
1043154560 8:76761753-76761775 CTTGATTTTCAAAATAAATGAGG + Intronic
1043325257 8:79042576-79042598 CTGCATATTAAAAATAAAACAGG - Intergenic
1044777660 8:95708869-95708891 CTGGCAATAAAGAATAAAAGAGG - Intergenic
1044991162 8:97797107-97797129 CTAGATATTAATAATAAAATTGG + Intronic
1045923636 8:107562745-107562767 CTGTATATTCAGAATAACAAAGG - Intergenic
1046004353 8:108461222-108461244 CTGGATATCCAGAAACACAGAGG - Intronic
1046256910 8:111712051-111712073 CTGGATTTACGGAATTAAAGTGG - Intergenic
1046374360 8:113356966-113356988 CTGGATATTATTAATAAAATAGG + Intronic
1046769567 8:118104898-118104920 CTGCATATTCAGAATGAACCAGG - Intronic
1047060783 8:121222570-121222592 CTGGATATCCGAAATAAATGAGG - Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1050889619 9:10807574-10807596 CTGTATATTTAGAATGAGAGGGG + Intergenic
1050994191 9:12192586-12192608 CAGGATATCCAGAATATTAGTGG + Intergenic
1051073094 9:13197044-13197066 CTGGATATTCCCACTAAAAGAGG - Intronic
1052733752 9:32319035-32319057 CAGAATATTCAGAAGAATAGAGG - Intergenic
1052745189 9:32433603-32433625 GTGGCTATTGAGAATAAAAATGG + Intronic
1052753741 9:32519675-32519697 CTTAATATTCAGAAAAAAATTGG + Intronic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1053192814 9:36087671-36087693 CTACATTTTCAGAATATAAGTGG - Intronic
1055245845 9:74241532-74241554 CTGGAGATAGAGAATAAAACAGG - Intergenic
1056278754 9:85019162-85019184 CTGGATATTGAGATTAGAATTGG + Intronic
1057713481 9:97468416-97468438 CTGGATGTGAAGAATAAAAAAGG + Intronic
1057986523 9:99721168-99721190 CTGGATATCCAAAACAAAAAGGG + Intergenic
1203583081 Un_KI270746v1:32326-32348 CTGCATATTAAGAATAAAACTGG - Intergenic
1187145620 X:16634615-16634637 CAGGTTATTAAGAAAAAAAGAGG + Intronic
1187320908 X:18236904-18236926 CTGAATCTTCAGAATGGAAGTGG + Intergenic
1188609617 X:32079681-32079703 CTAGATATTCTGAACCAAAGTGG + Intronic
1188886467 X:35556537-35556559 CTGGATAAACTGAATAAAAGAGG + Intergenic
1189094058 X:38119145-38119167 CTGGGAATTCTGAATAAAATTGG - Intronic
1190498530 X:51052832-51052854 CTTCCTATTCAAAATAAAAGTGG - Intergenic
1192219619 X:69188554-69188576 ATGGTTATACAGAAAAAAAGGGG - Intergenic
1193960784 X:87922925-87922947 CTGGATATTCAGGAAAGTAGTGG + Intergenic
1194557971 X:95385923-95385945 CTGGAAATCCAGAAGAAAACTGG + Intergenic
1196539177 X:116884689-116884711 CAGGACATTCAGGAGAAAAGAGG - Intergenic
1196591254 X:117487554-117487576 CAGAATAAACAGAATAAAAGAGG + Intergenic
1196598656 X:117575273-117575295 CTGTGTGTTCAGAACAAAAGAGG - Intergenic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1198972314 X:142296234-142296256 CTGCGTATGCAGAAAAAAAGTGG + Intergenic
1199338267 X:146644600-146644622 CTGGATACTAAGTAAAAAAGAGG + Intergenic
1199931175 X:152524026-152524048 CTGAATAGCCAGAATAATAGGGG + Intergenic
1200767120 Y:7089616-7089638 TTGTATATTTAGTATAAAAGGGG - Intronic
1201447803 Y:14077431-14077453 CTATATATTCAGAATCACAGTGG + Intergenic