ID: 1087877389

View in Genome Browser
Species Human (GRCh38)
Location 11:103374582-103374604
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 38, 1: 78, 2: 68, 3: 54, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087877385_1087877389 8 Left 1087877385 11:103374551-103374573 CCTTCTTACAGACTTGTTGAACG 0: 1
1: 0
2: 2
3: 17
4: 109
Right 1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG 0: 38
1: 78
2: 68
3: 54
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087877389 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intronic