ID: 1087877389 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:103374582-103374604 |
Sequence | CAAAATGCTGATAGTGATAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 497 | |||
Summary | {0: 38, 1: 78, 2: 68, 3: 54, 4: 259} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087877385_1087877389 | 8 | Left | 1087877385 | 11:103374551-103374573 | CCTTCTTACAGACTTGTTGAACG | 0: 1 1: 0 2: 2 3: 17 4: 109 |
||
Right | 1087877389 | 11:103374582-103374604 | CAAAATGCTGATAGTGATATGGG | 0: 38 1: 78 2: 68 3: 54 4: 259 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087877389 | Original CRISPR | CAAAATGCTGATAGTGATAT GGG | Intronic | ||