ID: 1087878263

View in Genome Browser
Species Human (GRCh38)
Location 11:103384663-103384685
Sequence CTAAGCTTCTTGAACTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087878263 Original CRISPR CTAAGCTTCTTGAACTGTCT GGG (reversed) Intronic
901295793 1:8160027-8160049 TTCAGCTTCTCCAACTGTCTTGG + Intergenic
901530053 1:9847027-9847049 CTAAGCTGCCTAAACTGTCATGG - Intergenic
901622941 1:10603728-10603750 CAAAGCTTCTTGGTCTCTCTGGG - Intronic
903510228 1:23869139-23869161 CTAAGCTATTTGAAATGCCTCGG - Intergenic
920764070 1:208814160-208814182 CTCAGCTTCTAGAATTGTTTGGG + Intergenic
921426916 1:215013913-215013935 CTTACCTTGTTGAACTGGCTAGG + Intronic
1064491383 10:15860628-15860650 CTGACCTTTCTGAACTGTCTGGG + Intergenic
1065891099 10:30121961-30121983 CCATGCTTCCTGTACTGTCTGGG - Intergenic
1068852179 10:61755955-61755977 CTAAGAATTTTGAACTCTCTTGG - Intronic
1071059024 10:81548298-81548320 CTAAGCCACTTGAGCTCTCTTGG + Intergenic
1071560443 10:86642778-86642800 CTAAGCCTCCAGAAATGTCTGGG - Intergenic
1071828513 10:89349350-89349372 ATAAGCTTCTTGATCTCACTGGG + Intronic
1073526008 10:104182926-104182948 ACAAGCTTCTTGACCTTTCTAGG + Intronic
1076171510 10:128323930-128323952 CTCAGGTGCCTGAACTGTCTGGG - Intergenic
1077862842 11:6198710-6198732 CTCAGCTTCTTCAGCTGTATAGG - Intergenic
1078545709 11:12245674-12245696 TTAAGCCTCCTGACCTGTCTGGG + Intronic
1078737334 11:14032628-14032650 CCAAGCTACTTGACCTCTCTGGG - Intronic
1081306563 11:41518927-41518949 CTAAGCTTCAAGAATTGGCTGGG + Intergenic
1085084527 11:73657882-73657904 CTGAGCCTCTTGCATTGTCTTGG + Intronic
1087229732 11:95646872-95646894 AGAGGCTTCTGGAACTGTCTGGG + Intergenic
1087672338 11:101122638-101122660 TTAAGCTAATTGAACTGTTTAGG - Intronic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088252806 11:107876190-107876212 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1089920090 11:122201410-122201432 CTTAGTTCCTTGAAATGTCTTGG - Intergenic
1095222112 12:39628025-39628047 CCAAGCTTCTGAAACTGCCTAGG - Intronic
1096368093 12:51045664-51045686 CTAAAATTCTGGAACTCTCTTGG - Intergenic
1097268024 12:57756781-57756803 CTTAGCCTCTTGCCCTGTCTTGG + Intronic
1101561600 12:105862528-105862550 CTAAGCCTCTTGAGCTGGCTGGG + Intergenic
1104117098 12:125760238-125760260 CCTACCTTCTTGAGCTGTCTTGG - Intergenic
1105208608 13:18243840-18243862 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1105679334 13:22709479-22709501 CTAACTTTCTTGATATGTCTGGG - Intergenic
1105959647 13:25319304-25319326 TGAAGCTTCTTGAATTTTCTAGG + Exonic
1105997687 13:25687831-25687853 CTAAGCCTCCTTAACTGGCTGGG + Intronic
1106613117 13:31302165-31302187 TAAGGCTTCTGGAACTGTCTTGG + Intronic
1107054074 13:36084283-36084305 CCAAGAATCATGAACTGTCTGGG - Intronic
1107325060 13:39232869-39232891 GTAGTCTTCTTGAACTGGCTGGG - Intergenic
1109289252 13:60453832-60453854 CTTTGCTTCTTGAGCTGGCTTGG + Intronic
1109950390 13:69495029-69495051 GTATGCTTCCTTAACTGTCTTGG + Intergenic
1110759759 13:79218658-79218680 CTAAGCTGCTTGCACTTTCAAGG + Intergenic
1111147345 13:84201139-84201161 CTAAGCTTCTCGAAATGACAAGG - Intergenic
1111752458 13:92350835-92350857 CTAAACTTTTTGAATTGTCTTGG - Intronic
1111849778 13:93558116-93558138 GTAAGTTTCTTAAACTCTCTGGG + Intronic
1118567327 14:67156412-67156434 TTAAGGTTCTTGTATTGTCTGGG + Intronic
1119398225 14:74344295-74344317 CTCAGCTTCTCCAACTGGCTGGG - Intronic
1124207546 15:27734572-27734594 CTAAGCTTCCAGACCTGTCCAGG + Intergenic
1126304293 15:47237558-47237580 CTTAGCTGCTTGAATTGGCTTGG + Intronic
1126885442 15:53144302-53144324 CAAAACTTCTTGAACTGGCTGGG + Intergenic
1130747094 15:86666520-86666542 CTTATCTTATTGAATTGTCTGGG + Intronic
1133586952 16:7204905-7204927 CTATGTCTCTTGCACTGTCTGGG + Intronic
1134317653 16:13134185-13134207 CTAAGCTACTTAACCTGTCTGGG + Intronic
1137346316 16:47665000-47665022 CCAAGCTGCTTGAAATGTGTGGG + Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1139571980 16:67818654-67818676 CTGGGCTTCTCGAACTGTCCTGG - Intronic
1142215570 16:88828094-88828116 CAAAGCTTCCTGAACTTTCCTGG - Intronic
1143394622 17:6582837-6582859 CTAAGGTTCTTGCATTGTATGGG - Intronic
1143572540 17:7769037-7769059 CTCTGCTTCTTGCACTGTCTCGG + Intronic
1148881025 17:50727296-50727318 CAATGCTTCTTGTACAGTCTGGG - Intronic
1149193807 17:54095422-54095444 CTAAGCTTCTAGATCTCACTGGG - Intergenic
1155902540 18:31409142-31409164 CTAAGACTCTTGAACTGGTTGGG - Intronic
1155960801 18:31993259-31993281 CCTAGCTTCTTGGGCTGTCTCGG + Intergenic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1157690260 18:49676003-49676025 CTAAGGTTTTGGAACTGTCTTGG + Intergenic
1158073308 18:53499015-53499037 CTATATTGCTTGAACTGTCTGGG - Intronic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
1160098213 18:75895689-75895711 CTAAGATTTTTGAATTGTATTGG - Intergenic
1165238022 19:34439230-34439252 CTAAGTTTCCTGAACAGTCATGG - Intronic
1167827607 19:51987979-51988001 CTATTCTTATTGAATTGTCTTGG - Intergenic
926499218 2:13632614-13632636 CTAAGCTGCTTGGAGTGTCATGG + Intergenic
926997350 2:18750790-18750812 CTAAGTTGCTTCAATTGTCTGGG + Intergenic
927199212 2:20568069-20568091 CTTAGCTTCTAGGACAGTCTGGG - Intronic
929670952 2:43876131-43876153 CTCAGCTTCATGGACTGTGTGGG - Intronic
930856067 2:56019960-56019982 CTAAGCATTTTCAGCTGTCTTGG - Intergenic
932065262 2:68550765-68550787 GTAAGGTTCTTGCACTGTTTGGG - Intronic
933379332 2:81523400-81523422 TTAAGCTTAATGAAGTGTCTAGG - Intergenic
933441834 2:82324513-82324535 CTGAGCTTCTTGATTTGTTTTGG + Intergenic
934894304 2:98100615-98100637 CTAAGCTTCTAGATCTATCCTGG - Intronic
936880217 2:117241493-117241515 TTGAGCTCCTTGACCTGTCTGGG - Intergenic
939209287 2:139151708-139151730 CTCAGCTTCTTGAATCTTCTTGG + Intergenic
940486756 2:154305737-154305759 CTATCTGTCTTGAACTGTCTGGG + Intronic
941050704 2:160730427-160730449 TAAAGCTGCTTGAACTGCCTGGG - Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
943509678 2:188809042-188809064 ATATGCTTCCAGAACTGTCTTGG - Intergenic
944032596 2:195254655-195254677 CTAAGATTCTTCAACTGGTTTGG - Intergenic
944377088 2:199058078-199058100 CTAAACTTCATGAACTGACCAGG + Intergenic
945146580 2:206744547-206744569 ATAAGCTTCTTGAAATTTGTTGG + Intronic
948846143 2:240683628-240683650 CCAAGCTTGTTGACCTGCCTGGG + Intergenic
948847714 2:240691100-240691122 CCAAGCTTGTTGACCTGCCTGGG - Intergenic
1169652160 20:7881293-7881315 CTAAGTTTCTTGAAATATGTTGG - Intergenic
1177576959 21:22970342-22970364 GTAAGATTCTTGAAATGTTTTGG - Intergenic
1179609225 21:42538832-42538854 CTTATCTTCTAGAGCTGTCTGGG - Intronic
1179639360 21:42737001-42737023 CCAAGCTTCCTAAAATGTCTGGG - Intronic
1180620678 22:17159586-17159608 CTCAGCTTCGCGGACTGTCTGGG + Intronic
1180767654 22:18355495-18355517 CCAAGGTTCTTGTACTGACTAGG - Intergenic
1180778652 22:18506895-18506917 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1180811378 22:18764203-18764225 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1181197529 22:21198457-21198479 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1181704218 22:24638724-24638746 CCAAGGTTCTTGTACTGACTAGG - Intergenic
1182396279 22:30038751-30038773 CTCAGCTGCTTCAACTTTCTGGG - Intergenic
1182507470 22:30794649-30794671 GTTAGCTTCTTAAATTGTCTGGG - Intronic
1183153897 22:36059073-36059095 CAAAGAATCTTGAAATGTCTAGG - Intergenic
1183606302 22:38868454-38868476 CGCAGCCTCTGGAACTGTCTGGG - Intronic
1184026694 22:41862959-41862981 CTAAGCTTTCTGACCTGTGTAGG + Intronic
1184447309 22:44556448-44556470 CTAAGCATCATGAAATGTCACGG + Intergenic
1203229270 22_KI270731v1_random:96378-96400 CCAAGGTTCTTGTACTGACTAGG - Intergenic
949809752 3:7993493-7993515 TTAAACTTTTTGAACTCTCTTGG + Intergenic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
951962456 3:28343676-28343698 CTAAGCTTCTTTACCTTTCCAGG - Intronic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
955701794 3:61688829-61688851 CTAAGCTTCTTCTACTGACAAGG - Intronic
956557005 3:70535351-70535373 GTAAGCTTCTTAATCAGTCTTGG - Intergenic
956596156 3:70969847-70969869 ATATGCTTCTCGAACAGTCTGGG + Intronic
956739398 3:72263481-72263503 CTGAGCTTCCTGCACAGTCTGGG + Intergenic
957031464 3:75246962-75246984 CTCAACTTCTTGAGCTATCTTGG + Intergenic
958554315 3:95654913-95654935 CTTTGCTTCTTGAGCTGGCTTGG + Intergenic
958597346 3:96244694-96244716 CTAATCTTCAGGAACTGTTTTGG - Intergenic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
963827938 3:149974939-149974961 CTAAGGTTTTTGGATTGTCTAGG - Intronic
963990623 3:151649283-151649305 ATAAGGTTCATGAACTATCTTGG + Intergenic
964122902 3:153205240-153205262 CTAAGTTTCTTAAGCTCTCTAGG + Intergenic
964301575 3:155292417-155292439 GTAATTTTTTTGAACTGTCTAGG + Intergenic
966201435 3:177362439-177362461 CAATGCTTCTTAAACTGTCATGG + Intergenic
966288561 3:178326930-178326952 CCAAGCTTCTGGAACAGCCTTGG - Intergenic
966374088 3:179277843-179277865 CTTTTCTTCTGGAACTGTCTGGG - Intergenic
969205651 4:5642963-5642985 CTGAGCATCTTTAACTGTCAAGG + Intronic
970040319 4:11789592-11789614 CTCTGATTCTTGAACTGGCTGGG - Intergenic
973578703 4:52319070-52319092 TTAAGCTACTAGAACTGGCTCGG + Intergenic
976005415 4:80423996-80424018 CTAAAGTTCTTGGACAGTCTGGG - Intronic
976048394 4:80981032-80981054 CTAAGTTACTTGAACTTTCCCGG - Intergenic
978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG + Intronic
980447171 4:132924430-132924452 CTAAGTTTCATGGATTGTCTAGG + Intergenic
982628273 4:157796668-157796690 CTTATCTTCTTTACCTGTCTGGG - Intergenic
982994501 4:162323939-162323961 CTTTGCTTCTTGAACTGGCTTGG - Intergenic
984709910 4:182876294-182876316 CTGAGCATCCTGGACTGTCTTGG - Intergenic
986848477 5:11782686-11782708 CTTTTCTTTTTGAACTGTCTGGG + Intronic
987632625 5:20494672-20494694 CTAAGCTCCTAGTTCTGTCTAGG + Intronic
990079331 5:51893244-51893266 CTTAGCTTTTTGAGCTATCTTGG - Intergenic
991959195 5:72025896-72025918 CTAAGCTTATTGTACTGGCTTGG - Intergenic
992010652 5:72523562-72523584 CTAAGCTTTCTGAATTGTATAGG + Intergenic
992416202 5:76554090-76554112 CTACCTTTGTTGAACTGTCTTGG - Intronic
992983990 5:82208529-82208551 CTTAGCTTCTTGTTTTGTCTAGG + Intronic
996308238 5:122075708-122075730 CAAAGCTCCTAGAACCGTCTTGG + Intronic
997700463 5:135894670-135894692 CTGAGCTTCTTGCCCTGGCTAGG - Intronic
999847551 5:155501309-155501331 TTATCCTTCTTGAACTGTTTTGG - Intergenic
1000518341 5:162268573-162268595 CTAAGTTTCTTCAAATATCTAGG + Intergenic
1001769824 5:174285493-174285515 CCAAACTTCTTGAGTTGTCTGGG - Intergenic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1005146588 6:22698193-22698215 CTATGTTTCTTGTACTATCTAGG - Intergenic
1005260470 6:24053408-24053430 ATAAGCTTCATGAATGGTCTTGG - Intergenic
1005276120 6:24220405-24220427 CTCCGCTTCTTGACCTGTCATGG - Intronic
1006685814 6:35832595-35832617 GATAGATTCTTGAACTGTCTGGG - Intronic
1006789825 6:36692610-36692632 CTAAGCTCCTTGAGCTATTTTGG + Intergenic
1013954420 6:115824232-115824254 CTAAGTTTCTTCAACTGTAAAGG + Intergenic
1014084718 6:117329936-117329958 CTAAGCTTACTGAACTCCCTGGG + Intronic
1016950504 6:149574919-149574941 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1021203195 7:17749721-17749743 GTAAGATTCTGAAACTGTCTGGG - Intergenic
1021572566 7:22081367-22081389 TGAAGCTTCTTTAAGTGTCTGGG - Intergenic
1022281911 7:28919590-28919612 CTAATTTTCTTGTGCTGTCTGGG + Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026080006 7:67209390-67209412 CAAAGCTTCTTGGATTGTCATGG - Intronic
1027786738 7:82589727-82589749 CTTTGCTTCTTGAGCTGGCTTGG + Intergenic
1030099057 7:105929020-105929042 CTCAGCAGCTTTAACTGTCTAGG + Intronic
1032186240 7:129729145-129729167 CTAATCGACTTGACCTGTCTGGG + Intronic
1038358079 8:26848784-26848806 CTCAGCTTACTGAACTGTGTAGG + Intronic
1039510595 8:38088953-38088975 CTGACCTTCCTGACCTGTCTTGG + Intergenic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1043520860 8:81044021-81044043 CAAGGCTTCTTGAACGGTCAAGG + Intronic
1044894423 8:96875555-96875577 CTATTCTTGTTGAACTGTCTGGG + Intronic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045526905 8:102948755-102948777 GTAAGGTTCTTGTCCTGTCTGGG - Intronic
1046023800 8:108698400-108698422 ATAAGTTACTTGAACTCTCTAGG + Intronic
1046090321 8:109495876-109495898 TTAAGGTTATTGAACTGACTTGG + Intronic
1047985391 8:130227899-130227921 CAAAGCTTCTTGCCCTTTCTGGG + Intronic
1051222461 9:14864129-14864151 CTAATTTTCTTGAACTGCTTTGG - Intronic
1052266283 9:26577400-26577422 CTAATTTACTTGAGCTGTCTGGG + Intergenic
1052513060 9:29446471-29446493 CTAAGCTTCTTCGTCTGCCTTGG - Intergenic
1056615422 9:88161220-88161242 CTAAGCATCTGGTACTGTATAGG - Intergenic
1057001218 9:91511784-91511806 CTGGGCTTCTTGCACTGGCTGGG - Intergenic
1057250484 9:93497230-93497252 CTCAGCTGCTTAAACTGTGTTGG - Intronic
1059187949 9:112293866-112293888 CTTAGTTTCTTGAATTGTGTTGG - Intronic
1061474052 9:130851264-130851286 CTAAGCTTCTTCTACACTCTAGG + Intronic
1062506027 9:136876981-136877003 TTAAGCCTCCAGAACTGTCTGGG - Intronic
1186610898 X:11137247-11137269 CTGAGTTTCCTGAACTGTGTTGG - Intergenic
1194170841 X:90578820-90578842 ATAAGCATCTTGATCTGTTTGGG + Intergenic
1196343539 X:114625225-114625247 CTATGCTTCTTGTACAGCCTGGG + Intronic
1197570037 X:128138014-128138036 CTCAGCTTCCTCAACAGTCTGGG + Intergenic
1198789568 X:140329018-140329040 TTAATATTCTTGAACTTTCTAGG + Intergenic
1200517075 Y:4156558-4156580 ATAAGCATCTTGATCTGTTTGGG + Intergenic
1200679672 Y:6195022-6195044 CTAAGCTTCTGGACCTGTGATGG + Intergenic