ID: 1087879347

View in Genome Browser
Species Human (GRCh38)
Location 11:103396758-103396780
Sequence CTGTATACACACACACAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087879345_1087879347 25 Left 1087879345 11:103396710-103396732 CCTAAATGAGTTTTCTTGCTTAA 0: 1
1: 0
2: 0
3: 27
4: 323
Right 1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG 0: 1
1: 0
2: 6
3: 74
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087879347 Original CRISPR CTGTATACACACACACAGCA TGG Intronic
900252507 1:1678461-1678483 GTGCACAGACACACACAGCAGGG - Intronic
902967824 1:20022619-20022641 ATATATATACACACACACCATGG - Intergenic
903317277 1:22518044-22518066 ATATATATACACACACAGGAAGG + Intronic
904698118 1:32341865-32341887 GTGCATACACACACACAACCAGG - Intergenic
905981089 1:42228757-42228779 CTCTATACACACACACATGGGGG + Intronic
906109028 1:43311386-43311408 CTGTCTACCCCCACACTGCATGG + Intronic
906435294 1:45790590-45790612 GTGTATATACACACACACAATGG + Intronic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
907078269 1:51597459-51597481 GTATATACACACACACACAAAGG + Intronic
907100296 1:51826746-51826768 ATGTATATACACACACAGTATGG - Intronic
907118011 1:51986701-51986723 CTGCTTATGCACACACAGCATGG + Intronic
907350263 1:53823866-53823888 ATGAAAATACACACACAGCAGGG - Intronic
908096821 1:60747909-60747931 ATGTATACACATACATAACATGG - Intergenic
909206111 1:72759734-72759756 ATATATACACACACATACCATGG - Intergenic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
909925476 1:81432879-81432901 CTGTATACACAACCATAGAACGG - Intronic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910325447 1:86001753-86001775 ATATATACACACACACACAAAGG + Intronic
912761689 1:112373092-112373114 TGTTATACACACACACACCATGG + Intergenic
912995407 1:114528093-114528115 CTCAATACATGCACACAGCAAGG - Intergenic
913271437 1:117097549-117097571 CTATAGACACATACAAAGCAAGG - Intronic
916181610 1:162088817-162088839 CTGGACACACACACACAGTCTGG - Intronic
916577452 1:166080375-166080397 GTGTTTACACAGGCACAGCAGGG + Intronic
917155162 1:171989763-171989785 CTTTAAACAGACACACACCAAGG - Intronic
918112776 1:181472043-181472065 ATGTAGACACACACACACAATGG + Intronic
918254804 1:182739661-182739683 CTGTCTACATACACAAATCAGGG - Intergenic
918486853 1:185038146-185038168 ATATATGCACACACACAGAAAGG + Intergenic
918670515 1:187209630-187209652 ATGTATACACACACACACACAGG - Intergenic
919243621 1:194948581-194948603 ATATACACACACACACACCATGG + Intergenic
919288322 1:195595026-195595048 ATATATACACACACACACAATGG + Intergenic
923914252 1:238485075-238485097 CAGTATACACACACACACACAGG + Intergenic
924468623 1:244320017-244320039 ATGTATATTCACACACATCAGGG + Intergenic
924816130 1:247443579-247443601 CTGCAGACACCCACACTGCAGGG - Intronic
1065079521 10:22113688-22113710 ATATATACACACACACACAATGG - Intergenic
1066119627 10:32272576-32272598 ATGTATACACACACAATGAAAGG + Intronic
1066489336 10:35878946-35878968 ATATATACACACACACACCATGG + Intergenic
1066622559 10:37374047-37374069 GTGAATACGCACACGCAGCAGGG + Intronic
1066753343 10:38683218-38683240 ATATATACACACACAGACCATGG + Intergenic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068109149 10:52658459-52658481 ATGTACACACACACACACAATGG - Intergenic
1068114939 10:52726848-52726870 ATAAATACACACACACACCATGG + Intergenic
1068702786 10:60037651-60037673 ATGTACACACACATACACCATGG - Intronic
1069160577 10:65086220-65086242 ATATATACACACACACACCATGG + Intergenic
1069360389 10:67634783-67634805 CTATATACATACACACAATATGG + Intronic
1069553987 10:69384702-69384724 GTGTATACACACACACACGTAGG - Intronic
1069576162 10:69530048-69530070 ATATAAACACACACACACCATGG - Intergenic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1071306249 10:84301302-84301324 GTGTATACACACACACGCAAAGG - Intergenic
1071693742 10:87850471-87850493 AAATATACACACACACACCAAGG - Intergenic
1072136529 10:92551965-92551987 ATCTATACACACACACAAAAAGG + Intronic
1072268542 10:93753488-93753510 CTTCATACACACACAAAGAATGG + Intergenic
1072641049 10:97211503-97211525 CTGTATCCACACCCACCACAGGG + Intronic
1073493142 10:103868385-103868407 CTGGATATACCCACACGGCATGG + Intergenic
1073820660 10:107259922-107259944 ATATATATACACACACACCATGG + Intergenic
1073877222 10:107938908-107938930 ATATATACACACACACACTATGG + Intergenic
1074036944 10:109748884-109748906 ATATACACACACACACACCATGG - Intergenic
1075164013 10:120050495-120050517 ATATATATACACACACACCATGG + Intergenic
1075444919 10:122506444-122506466 CTGAAGCCACACACACACCAAGG - Intronic
1075479268 10:122765843-122765865 CTGTACAAAGACACACATCAGGG - Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076211615 10:128651007-128651029 ATATATACACACATACACCATGG - Intergenic
1076211617 10:128651054-128651076 ATATATACACACACACACCATGG + Intergenic
1076663724 10:132073110-132073132 CTACATACACACACACAACATGG - Intergenic
1076755097 10:132565534-132565556 ATATATACACACACACAGGAAGG - Intronic
1077237281 11:1487827-1487849 CTGCACGCACACACACAGCCTGG + Intronic
1078034748 11:7791555-7791577 CTGTGTACACACACACACAATGG + Intergenic
1078187798 11:9066968-9066990 CTGCATACACAGACACCACAGGG - Intronic
1078982090 11:16547424-16547446 ATGTACACACACACACACAATGG + Intronic
1079027367 11:16960058-16960080 GTGTGTGCACACACACAGCCTGG - Intronic
1079698264 11:23511304-23511326 CTGTATATACACACACATGTAGG - Intergenic
1079799131 11:24846820-24846842 ATGTATACACACACACATAGAGG - Intronic
1087013678 11:93536576-93536598 CTGTATACACAAATACACTATGG - Intronic
1087517930 11:99189200-99189222 ATGTATACACACACACACTATGG - Intronic
1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG + Intronic
1087974266 11:104525149-104525171 ATATATACACACACACACAATGG - Intergenic
1088134089 11:106532515-106532537 CTGTATACACAGTCACCGCCAGG + Intergenic
1088746649 11:112809643-112809665 TTATATTCACACACACAGCTTGG + Intergenic
1089544573 11:119213313-119213335 TTGTGTACACAAACACAGGAAGG - Intronic
1090488377 11:127135484-127135506 CTGCATACACAGACACCACAGGG + Intergenic
1090680069 11:129046108-129046130 CCGTATACACACTCCCATCATGG + Intronic
1091076359 11:132621478-132621500 CTATTAAAACACACACAGCATGG + Intronic
1091513534 12:1154198-1154220 ATACATACACACACACACCATGG - Intronic
1092116244 12:6010324-6010346 CTGTAACAACACACTCAGCAAGG + Intronic
1092942936 12:13427548-13427570 ACATATACACACACACAGGATGG + Intergenic
1093072465 12:14721266-14721288 ATGTATACACACATACACAATGG - Intergenic
1093603117 12:21055064-21055086 CTGTAAATTCACCCACAGCATGG + Intronic
1093720216 12:22433204-22433226 ATATATACACACACACACCATGG - Intronic
1095839741 12:46680034-46680056 GTGTACACACACACACAGGATGG + Intergenic
1098406600 12:70132857-70132879 ATGCATACACACACACACGATGG - Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1099320057 12:81135466-81135488 ATATACACACACACACACCATGG + Intronic
1099728728 12:86469460-86469482 CTGGATAGGCACACACAGCAAGG + Intronic
1099994174 12:89759129-89759151 ATGTATACCCACACATACCATGG + Intergenic
1100242996 12:92728561-92728583 GTGTACACATACACACACCATGG - Intronic
1100400082 12:94221772-94221794 CTGTATTCTCACATACAGAAGGG + Intronic
1102404027 12:112656780-112656802 ATATATACACACACACACCGTGG - Intronic
1102765022 12:115425245-115425267 ATACATACACACACACACCATGG + Intergenic
1103036009 12:117656907-117656929 ATGTATACACACACACACAAAGG - Intronic
1103505201 12:121438350-121438372 TTGCATGCACACACACAGCATGG + Intronic
1104312815 12:127669860-127669882 CAGTATACACACATACACAATGG - Intergenic
1106019667 13:25902608-25902630 GTGCATACACACACGCAGAATGG - Intronic
1106056670 13:26244483-26244505 GTGTATACACACACACATAGAGG + Intergenic
1107584421 13:41829567-41829589 ATGCACACACACACACACCATGG + Intronic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1108700793 13:52942252-52942274 ATGTATTCACACACACAGTTTGG - Intergenic
1109055552 13:57543679-57543701 CTATATATACACACATAGCAGGG + Intergenic
1109377641 13:61518891-61518913 TTATATACACACACACAAAATGG - Intergenic
1109488400 13:63059090-63059112 CTATATACACATACACAGGAGGG + Intergenic
1109630810 13:65043859-65043881 GTTTATACACACACACAACATGG - Intergenic
1109911116 13:68911668-68911690 ATATACACACACACACATCATGG + Intergenic
1109924891 13:69123946-69123968 ATATACACACACACACAGCATGG + Intergenic
1110441189 13:75527635-75527657 GTGTATACATACACACACAATGG + Intronic
1110885236 13:80624650-80624672 ATATATACACACACACACAATGG - Intergenic
1111240340 13:85465434-85465456 CAGTATTCACTCACACAGGAAGG - Intergenic
1112455237 13:99554996-99555018 AGATATACACACACACAGAATGG - Intronic
1112539197 13:100290567-100290589 ATGTATACAAACACAAACCAAGG - Intronic
1112890190 13:104220045-104220067 ATATATATACACACACACCATGG + Intergenic
1113409806 13:110074965-110074987 CGGTATATACACACACATCTAGG - Intergenic
1113778348 13:112961653-112961675 CTGTGGCCACACACACAGCTGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116449152 14:45045528-45045550 ATATATACACACACAGACCATGG - Intronic
1116668610 14:47811983-47812005 ATATATACACATACACACCATGG - Intergenic
1117177612 14:53161091-53161113 ATGTATATACACACACAGTGTGG - Intergenic
1117435659 14:55713166-55713188 CTTTAGACACACACAAAGCAAGG + Intergenic
1118609690 14:67530500-67530522 CTTTATATACACACACTACATGG - Intronic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119843687 14:77812490-77812512 ATATATACACACACACACTATGG - Intronic
1120224062 14:81770385-81770407 ATATATACACACACACGCCATGG + Intergenic
1120255011 14:82107435-82107457 ATGCATGCACACACACAGTAAGG + Intergenic
1120264169 14:82228055-82228077 GTGTATAAATACATACAGCATGG - Intergenic
1120713932 14:87820326-87820348 GTGTATACACACACACATCTTGG - Intergenic
1120974086 14:90233872-90233894 ATATATACACACACACATAAAGG - Intergenic
1122106033 14:99455712-99455734 CTGTATATAAATACAAAGCAGGG + Intronic
1122175025 14:99910773-99910795 CTGTTTGCTCACAGACAGCAGGG - Intronic
1122928207 14:104919754-104919776 ATATATACACACACACACAATGG - Intergenic
1124910735 15:33917618-33917640 ATATATATACACACACACCATGG + Intronic
1125006240 15:34821033-34821055 CTGTATACACACTAACTCCAAGG + Intergenic
1126426869 15:48537289-48537311 CTGTGTAGAAACACAAAGCAAGG - Intronic
1126977746 15:54203928-54203950 ATATATACACACACACACAATGG + Intronic
1127629021 15:60808778-60808800 ATATATACACACACACACCATGG + Intronic
1128562717 15:68679113-68679135 CTGTATCCCAACACCCAGCACGG - Intronic
1129219892 15:74126069-74126091 CTTTGCACACACACACACCATGG - Intronic
1129560216 15:76558823-76558845 ATACATACACACACACACCATGG + Intronic
1129691876 15:77718451-77718473 CTGTATACACATACACACATGGG - Intronic
1130171006 15:81513853-81513875 GTGTGTGCAAACACACAGCAGGG + Intergenic
1131902033 15:97098548-97098570 ATATACACACACACACACCATGG + Intergenic
1132145786 15:99428708-99428730 GTATATACACACATACAGCAAGG - Intergenic
1132169339 15:99632185-99632207 ATTTATACACACACACACGAAGG + Intronic
1132440844 15:101862893-101862915 CTGTACACAGGCAAACAGCAGGG - Intergenic
1133589292 16:7227292-7227314 CCCCACACACACACACAGCAAGG + Intronic
1134220327 16:12348529-12348551 ATGTACACACACACAGAGCCGGG - Intronic
1134428870 16:14181962-14181984 GTGCATACACACAAACACCATGG + Intronic
1135117317 16:19734829-19734851 CTGCTTCCACACACAAAGCAGGG - Intronic
1138030297 16:53554508-53554530 CCCTATACAAAGACACAGCATGG + Intergenic
1138056580 16:53840580-53840602 CTGCTTTCACACAGACAGCAAGG - Intronic
1138830962 16:60374192-60374214 TTGTACACACAAACACATCACGG - Intergenic
1202997031 16_KI270728v1_random:123748-123770 ATATATACACACACAGACCATGG + Intergenic
1203023718 16_KI270728v1_random:436090-436112 ATATATACACACACAGACCATGG + Intergenic
1143752396 17:9038018-9038040 CTGTGTACCCACTAACAGCAAGG - Intronic
1144011469 17:11152213-11152235 GTGTATACACAAGCACACCATGG + Intergenic
1144199618 17:12928508-12928530 ATGTACACACACACACAGTATGG - Intronic
1144246299 17:13369189-13369211 ATATATACACACACGCACCATGG - Intergenic
1145759229 17:27416486-27416508 CTGTATAAACTCACTCAGGAAGG - Intergenic
1145799765 17:27675549-27675571 CTGTATAAACTCACTCAGGAAGG + Intergenic
1146552101 17:33789672-33789694 CTCAATACACACACACACAAAGG - Intronic
1146845127 17:36177746-36177768 CTGTATATACTCACTCAGGAAGG + Intronic
1146857440 17:36265682-36265704 CTGTATAAACTCACTCAGGAAGG + Intronic
1146863179 17:36322693-36322715 CTGTATAAACTCACTCAGGAAGG - Intronic
1146873348 17:36389595-36389617 CTGTATATACTCACTCAGGAAGG + Intronic
1146880702 17:36440677-36440699 CTGTATATACTCACTCAGGAAGG + Intergenic
1147066042 17:37923278-37923300 CTGTATAAACTCACTCAGGAAGG - Intergenic
1147076232 17:37990218-37990240 CTGTATAAACTCACTCAGGAAGG + Intronic
1147077571 17:38002841-38002863 CTGTATAAACTCACTCAGGAAGG - Intronic
1147087757 17:38069763-38069785 CTGTATAAACTCACTCAGGAAGG + Intergenic
1147093506 17:38126776-38126798 CTGTATAAACTCACTCAGGAAGG - Intergenic
1147103701 17:38193712-38193734 CTGTATAAACTCACTCAGGAAGG + Intergenic
1147267628 17:39244434-39244456 CTGCAGGCAAACACACAGCAAGG - Intergenic
1147746560 17:42698493-42698515 CTGTATACATACACACACTTTGG - Intronic
1148812047 17:50299450-50299472 ATGTACACACACACACACCCTGG - Intergenic
1148918808 17:51010611-51010633 ATGTATACACACACACATTTAGG + Intronic
1149016925 17:51918472-51918494 ATGTATACACGCACACAGTTTGG - Intronic
1149112119 17:53046536-53046558 CTCCACACACACACACAGGAGGG - Intergenic
1149137466 17:53386029-53386051 ATATATACACACACACAGGATGG + Intergenic
1149165253 17:53743685-53743707 GTGTATACACAGACACATGATGG - Intergenic
1151430326 17:74058010-74058032 CTGTGTAAACACACACACCTGGG - Intergenic
1151976613 17:77487214-77487236 CTGTGTAAACCCACACAGCCGGG - Intronic
1155244338 18:23893124-23893146 CTGTATATACACACAAAGTGTGG + Intronic
1156918104 18:42485308-42485330 GTGCACACACACACACACCATGG - Intergenic
1157119278 18:44893825-44893847 CTGTACACACACACACAAATAGG - Intronic
1157192768 18:45595179-45595201 ATGTATGCAAACACACAGAAAGG - Intronic
1157545017 18:48540696-48540718 GTGTGTACACACAAACAGCCGGG - Intronic
1158817124 18:61115340-61115362 ATATATATACACACACACCATGG - Intergenic
1159111681 18:64066336-64066358 ATATATACACACACACACAATGG - Intergenic
1160480053 18:79231798-79231820 ATATATACACACACACACCATGG + Intronic
1160517835 18:79488245-79488267 CCGCAAACACACACACACCAGGG - Intronic
1161588214 19:5117066-5117088 CTCAATGCACAGACACAGCAAGG - Intronic
1161610167 19:5237958-5237980 CTGTGTACACACACCCAGGGCGG + Intronic
1161677618 19:5661299-5661321 CTGATCACACACACACAGCCTGG + Intronic
1163074233 19:14874754-14874776 TTATATACACACACACACCGTGG - Intergenic
1164683063 19:30148791-30148813 CTGCACACAGACACACAGAAAGG + Intergenic
1164874221 19:31671914-31671936 ATATACACACACACACAGCCTGG + Intergenic
1164882599 19:31746468-31746490 ATGTACACACACACACACAATGG + Intergenic
1166017293 19:39991963-39991985 ATATATATACACACACACCAAGG - Intronic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1166267794 19:41695800-41695822 CTGAATCCACCCACCCAGCAAGG - Intronic
1167153440 19:47723226-47723248 CAGCCTCCACACACACAGCAGGG + Intronic
1167560575 19:50224326-50224348 CTGCACACACTCACACAGCAGGG - Intronic
1168123609 19:54270467-54270489 GTATATACACACACACAGCACGG - Intronic
924968725 2:102891-102913 ATATATACACACACACACAAAGG - Intergenic
925441592 2:3891705-3891727 CAATACACACACACACACCAAGG - Intergenic
926540876 2:14179733-14179755 ATGTATACATAAACACAGCATGG - Intergenic
926773126 2:16396117-16396139 ATGTACACACACACACCCCATGG + Intergenic
927074055 2:19559319-19559341 CTGTATTCAGACACACAGAGAGG + Intergenic
927370675 2:22351711-22351733 ATATATACACACACACACTATGG + Intergenic
927565125 2:24105047-24105069 CTGGAAACACCCAGACAGCAGGG + Intronic
927677700 2:25118434-25118456 GTGTATACACACACACACAGTGG - Intronic
928297775 2:30099781-30099803 ATATATACACACATACACCATGG - Intergenic
928664333 2:33535885-33535907 CTGTATGCACACATACAATAGGG - Intronic
928808575 2:35193599-35193621 ATATATACACACATACACCATGG + Intergenic
928905872 2:36366946-36366968 TTATAAACACACACACAGAAAGG - Intronic
928962845 2:36946558-36946580 CTGTATACACACACACACGTGGG - Intronic
929902970 2:46021829-46021851 CTGGACACACACACACAAAAAGG - Intronic
930080415 2:47442039-47442061 ATATATACACACACACACAATGG - Intronic
930209873 2:48624907-48624929 CTGTATACACACACACACAGAGG - Intronic
930891121 2:56389225-56389247 ATGTATACACGCACACACCATGG - Intergenic
931717851 2:65043223-65043245 CTGTACACTCAGACACATCAGGG + Intergenic
931966084 2:67536527-67536549 TTTCATACACACACACACCACGG + Intergenic
933325238 2:80827298-80827320 ATGTATACACACACATAGGTTGG - Intergenic
934111931 2:88752060-88752082 CTTTAGGCACACATACAGCAAGG + Intergenic
934316779 2:91928896-91928918 ATATATACACACACAGACCATGG + Intergenic
935690241 2:105724775-105724797 ATATATATACACACACACCATGG + Intergenic
935734737 2:106097519-106097541 CTATATACAGAAGCACAGCAGGG + Intronic
936407771 2:112222410-112222432 CTGGAAACACCCAGACAGCAGGG - Intronic
936984225 2:118292880-118292902 ATATATACACACACACACAATGG - Intergenic
937039627 2:118810843-118810865 GTGCAGACACTCACACAGCACGG + Intergenic
937553305 2:123122280-123122302 ACGCATACACACACACACCATGG + Intergenic
937831087 2:126424373-126424395 TGGTATACACAAACACACCATGG + Intergenic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
938598905 2:132817499-132817521 CTTTATACACAAAAACATCAGGG - Intronic
938625900 2:133108890-133108912 GTGTATACACACAGACACAATGG - Intronic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
939583959 2:143984693-143984715 GTGGACACACACACACAGAAGGG + Intronic
940957279 2:159741907-159741929 CTGGACACACACACACAGACAGG - Intronic
941252097 2:163178733-163178755 CTGTATCCACCCACAGAGGATGG + Intergenic
941813805 2:169780640-169780662 CTGTTCACACACACACTGCCTGG + Intergenic
942125202 2:172817968-172817990 ATATATATACACACACACCATGG + Intronic
942851159 2:180488444-180488466 ATGTATATACACACACACCTTGG - Intergenic
943447189 2:188001834-188001856 ATATATATACACACACACCATGG + Intergenic
943556972 2:189417799-189417821 ATATATACACACACACACAATGG - Intergenic
944627045 2:201581454-201581476 ATGTATACACACACACATTCCGG + Intronic
945014951 2:205505413-205505435 ATGAATACACACACACTGTAAGG + Intronic
945220143 2:207475053-207475075 TTGTCTACACAAACACAGAATGG - Intergenic
945526542 2:210894848-210894870 TTACATACACATACACAGCATGG - Intergenic
945633489 2:212316276-212316298 ATGTACACACACACACTGCAAGG + Intronic
946102782 2:217341013-217341035 ATATATACACACACACACAATGG + Intronic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
946874969 2:224119813-224119835 ATATATACACACACACACTATGG + Intergenic
947826691 2:233110521-233110543 ATGCACACACACACAAAGCAGGG - Intronic
948275408 2:236704453-236704475 CTGTACACACACACACAGAATGG + Intergenic
1168736603 20:145171-145193 CTGTATACAAACACTTACCAGGG - Intronic
1168780206 20:482770-482792 TTATATATATACACACAGCAAGG + Exonic
1168908436 20:1425629-1425651 CTGTAAATAAATACACAGCAAGG - Intergenic
1169722348 20:8692595-8692617 GTGTATTCCCTCACACAGCAAGG + Intronic
1170301293 20:14887123-14887145 ATGTATGCACACATACAGCCAGG - Intronic
1170493681 20:16903576-16903598 ATGTATACACACACACAAGTGGG + Intergenic
1170754251 20:19184802-19184824 ATATACACACACACACACCATGG + Intergenic
1171198116 20:23217405-23217427 CTATATATACACACACACCATGG - Intergenic
1171347954 20:24479972-24479994 CTGCACACACACACACTCCATGG + Intronic
1172235816 20:33373313-33373335 CTTTACACACACACACACCTGGG - Intronic
1173397888 20:42697573-42697595 GGGTCTTCACACACACAGCAAGG + Intronic
1173777264 20:45720477-45720499 ATATATACACACACACACCATGG + Intergenic
1174216266 20:48918959-48918981 CCCAACACACACACACAGCAAGG - Intergenic
1175000158 20:55619130-55619152 GTGTATACACACACACAGAATGG + Intergenic
1175487028 20:59353991-59354013 CAGAAGACACACACACACCAGGG - Intergenic
1175824196 20:61927803-61927825 CTGCACACACGCACACAGCGGGG - Intronic
1176889336 21:14295275-14295297 ATATACACACACACACACCATGG + Intergenic
1177209982 21:18059182-18059204 CTCTGTACACACACAGAGAAAGG + Intronic
1177224237 21:18232998-18233020 CTATATATACACACACAGTGTGG + Intronic
1177737676 21:25112982-25113004 ATATATACACACACACACCATGG - Intergenic
1178754874 21:35339121-35339143 CTATATAGATACACACACCACGG - Intronic
1179109011 21:38429241-38429263 GTATATACACACACACACCATGG - Intronic
1179206467 21:39285118-39285140 GTGTATACACACACACAAAATGG + Intronic
1179268399 21:39826413-39826435 ATATATACACACACACACTATGG - Intergenic
1179402420 21:41096364-41096386 CTGTATCCACTCATACAGAAAGG + Intergenic
1180543110 22:16471243-16471265 ATATATACACACACAGACCAGGG + Intergenic
1180983749 22:19892035-19892057 CGGTGCACACACACACAGAAGGG - Intronic
1181366800 22:22382776-22382798 ATGTATACATACACATACCAGGG - Intergenic
1181373161 22:22433925-22433947 ATGTATACATACACATACCATGG - Intergenic
1181858483 22:25799971-25799993 ATATATATACACACACACCATGG + Intronic
1183369860 22:37426447-37426469 GTGTATACAGACAGAGAGCAGGG + Intronic
1183618715 22:38960322-38960344 CTGGATCCACACACACTGCTTGG + Intronic
1183623917 22:38990267-38990289 CTGGATCCACACACACTGCTTGG + Intronic
1183718914 22:39550830-39550852 GTACATACACACACACAGCGGGG + Intergenic
1184368180 22:44065838-44065860 ATGCACACACACACACACCATGG - Intronic
1184864879 22:47196509-47196531 ATGTCTGCACACCCACAGCAGGG - Intergenic
949171643 3:1006034-1006056 ATATATAGACACACACACCATGG + Intergenic
949867426 3:8557922-8557944 CTGGGAAGACACACACAGCAGGG + Intronic
950426894 3:12929164-12929186 CATTATACAGACACACAGAAAGG - Intronic
950730948 3:14956833-14956855 GTGTAAACACACACACAGCCGGG - Intronic
952413613 3:33071070-33071092 CTGTCTACCTACAGACAGCATGG + Intronic
952592806 3:34977735-34977757 AGGTATACACACACACACCATGG - Intergenic
952972076 3:38657740-38657762 ATTGATACACACACACAACATGG + Intergenic
953982486 3:47419654-47419676 TGGTATACACAGACCCAGCAGGG - Exonic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
955140784 3:56267247-56267269 CTGTATACACACACACACAGTGG + Intronic
955558392 3:60162584-60162606 CTATATACAGGCACACAGTAGGG - Intronic
956337555 3:68181009-68181031 CTGCATAAACACACAAAGTACGG + Intronic
956584599 3:70851145-70851167 TTGTTTACAAACACACACCAAGG - Intergenic
957587980 3:82157505-82157527 CTTTACAAACATACACAGCATGG + Intergenic
958680709 3:97327822-97327844 ATATATACACACACACACCAAGG - Intronic
958726691 3:97914261-97914283 AAATACACACACACACAGCAAGG + Intronic
959006201 3:101022661-101022683 ATATATACACATACACACCATGG - Intergenic
959362358 3:105409339-105409361 ATATATATACACACACACCATGG + Intronic
959463750 3:106659233-106659255 ATATATACACACACACACCATGG + Intergenic
959577047 3:107945606-107945628 ATGCATACACACAAACAGAATGG + Intergenic
959579498 3:107969113-107969135 ATATATACACACACACAGCAAGG + Intergenic
959642157 3:108653492-108653514 ATATATACACACACACACAATGG - Intronic
959902274 3:111674495-111674517 CTGTCTACACACACACTGGAAGG + Intergenic
960017252 3:112905524-112905546 ATATATATACACACACACCATGG - Intergenic
961147315 3:124605252-124605274 CTCTATAACCACACACAGAAAGG - Intronic
962262511 3:133922578-133922600 ATGTATACACACACACAACATGG - Intergenic
962672465 3:137722948-137722970 ATACATGCACACACACAGCAGGG + Intergenic
963013318 3:140796627-140796649 ATATATATACACACACACCATGG - Intergenic
963832973 3:150028675-150028697 ATATATACACACACACACCATGG + Intronic
964288692 3:155151143-155151165 CTGTCTAAACATACACAGCAAGG - Intronic
964407218 3:156361447-156361469 ATATATACACACACATATCAAGG - Intronic
964536124 3:157724291-157724313 ATAAATACACACACACACCAGGG - Intergenic
964774209 3:160257286-160257308 ATATATACACACACACACAAAGG - Exonic
965513289 3:169592891-169592913 ATGTATTTACACACACATCATGG + Intronic
965685733 3:171300274-171300296 CTGTTGGCACTCACACAGCACGG + Intronic
965963836 3:174461824-174461846 ATGCATACACACACACAGTGTGG - Intronic
966270833 3:178103449-178103471 CTATATTTACATACACAGCAAGG + Intergenic
967175422 3:186859151-186859173 ATATATATACACACACACCATGG - Intergenic
968885461 4:3328635-3328657 ATATATACATACACACAGTAGGG + Intronic
969236072 4:5865849-5865871 GTGCACACACACACACAGAAAGG + Intronic
969924519 4:10573820-10573842 CTGTACCCACAGACACAGAAGGG - Intronic
970208079 4:13676176-13676198 ATATATACACACACACACCATGG - Intergenic
970503502 4:16703017-16703039 GTGTATAGACATACACAGGAAGG - Intronic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971349702 4:25844906-25844928 CTATGTGCACACACACAGAAAGG + Intronic
971580345 4:28330811-28330833 TTCTATACACACACACAGCCTGG - Intergenic
971927501 4:33032109-33032131 CAGTATACACAGACATAACATGG + Intergenic
971938113 4:33179810-33179832 GTAAATACACACACACAACATGG + Intergenic
972049485 4:34711113-34711135 ATATATACACACACACACTAAGG + Intergenic
972516983 4:39818236-39818258 CTCTCTACACATACACAGCTTGG - Intergenic
972537047 4:40008474-40008496 CTAGTTACACACACAGAGCATGG + Intergenic
972827292 4:42774428-42774450 ATATACACACACACACACCATGG - Intergenic
973675574 4:53258525-53258547 ATATATATACACACACACCATGG - Intronic
974376214 4:61080014-61080036 ATGTACACACACACACACCATGG + Intergenic
975053111 4:69891386-69891408 ATGTTTATACACACACAACATGG - Intergenic
976605835 4:86981888-86981910 CAGTTTATACACAGACAGCAAGG + Intronic
977229685 4:94437330-94437352 ATATATATACACACACACCATGG + Intergenic
978199424 4:106007864-106007886 ATATATACACATACACACCATGG - Intergenic
978783558 4:112582840-112582862 ATGTAAACACACACACACAATGG - Intronic
979098996 4:116591138-116591160 ATATATACACACACACACCATGG - Intergenic
979181926 4:117740773-117740795 ATATATATACACACACACCATGG + Intergenic
979181927 4:117740790-117740812 ATATATATACACACACACCATGG - Intergenic
979455762 4:120923807-120923829 CAGACTACACACACACACCATGG + Intergenic
979497934 4:121405664-121405686 ATATATACACACACACATAATGG - Intergenic
979709684 4:123764309-123764331 ATATATACACACACACACAATGG - Intergenic
980504771 4:133703356-133703378 GTATATACACACACACACTAAGG - Intergenic
980670792 4:136004151-136004173 ATGTTTACACACAGACACCAAGG - Intergenic
980722617 4:136717507-136717529 CAGCATACACACAGACAGGAAGG - Intergenic
980806584 4:137823007-137823029 TTACATACACACACACAGCAGGG - Intergenic
980892923 4:138833800-138833822 CTATTTACACAGAAACAGCATGG + Intergenic
981887155 4:149690206-149690228 ATGTATATACACACACACAATGG + Intergenic
982419110 4:155173039-155173061 ATATATACACACACATACCATGG - Intergenic
982702635 4:158672750-158672772 CTGTCAACACACACACACCTCGG + Intronic
982959703 4:161821774-161821796 ATATATATACACACACACCATGG - Intronic
982992307 4:162293432-162293454 ATGTACACACACACACACCATGG + Intergenic
983124350 4:163931904-163931926 CTGTATATAAAGGCACAGCATGG + Intronic
983249159 4:165325763-165325785 CAGTATACACTGAGACAGCAGGG + Intergenic
984130906 4:175874966-175874988 CAGTATACACACACACACCTTGG - Intronic
984261517 4:177448709-177448731 ATATATACACACACACACCATGG - Intergenic
984486217 4:180373889-180373911 TTTAAAACACACACACAGCATGG - Intergenic
984510244 4:180670152-180670174 CTCTCTACACACATACAACAAGG - Intergenic
984593476 4:181641541-181641563 ATATATATACACACACACCATGG - Intergenic
984965246 4:185134209-185134231 CTCTACACACACACACAAAAAGG - Intergenic
985240125 4:187921984-187922006 ATGTATACACACACAGAGAGAGG - Intergenic
985254747 4:188058583-188058605 GTGTATACACACACACACAAAGG + Intergenic
985572270 5:653972-653994 GGGCACACACACACACAGCAAGG - Intronic
985634770 5:1030643-1030665 CTTTGTACATCCACACAGCAGGG - Intronic
985967095 5:3345895-3345917 ATTTATACACACACAGAGAAAGG - Intergenic
986023375 5:3825832-3825854 CTGTTTTCATACACATAGCATGG - Intergenic
986299841 5:6469582-6469604 ATATATACACACACACACTAAGG + Intronic
987884072 5:23790142-23790164 ATATATACACACACACATCCTGG + Intergenic
988258881 5:28857240-28857262 ATATATACACACACACACCATGG - Intergenic
988424122 5:31042956-31042978 GTGTATACACACACACAACATGG + Intergenic
988741328 5:34075901-34075923 GTGTATACACACACACACGGTGG + Intronic
988988842 5:36649391-36649413 CTCTATCCACACACACAAAAAGG + Intronic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
990017766 5:51086281-51086303 ATATATACACACACACACCACGG - Intergenic
990097118 5:52130501-52130523 ATATATACACACACACAGTTAGG + Intergenic
990805505 5:59656282-59656304 ATATATACACACTCACAGAAGGG + Intronic
991015761 5:61930453-61930475 ATATGTACACACACACACCATGG - Intergenic
991408114 5:66321260-66321282 ATATATACACACACACACAATGG + Intergenic
991415805 5:66391841-66391863 ATATATACACACACACACCATGG + Intergenic
992173374 5:74125681-74125703 CTATTTTCACACAAACAGCAAGG - Intergenic
994339013 5:98603427-98603449 ATATATACACACACATATCATGG + Intergenic
994540312 5:101086936-101086958 GTGTATATACACACACACAAAGG - Intergenic
994765078 5:103905275-103905297 ATATATATACACACACACCATGG - Intergenic
995047325 5:107667778-107667800 CTATATAAAGACACAAAGCATGG + Intronic
995229044 5:109737711-109737733 ATGTAGACACACACAGAACATGG + Intronic
995530573 5:113088001-113088023 ATGTGTGCACATACACAGCAAGG - Intronic
995783485 5:115802923-115802945 CTATATACACATATTCAGCATGG - Intergenic
996253212 5:121364359-121364381 ATATATATACACACACAGTATGG - Intergenic
996437977 5:123456901-123456923 GTATATACACACACACACAAAGG + Intergenic
996916647 5:128720283-128720305 CTGTATGCACACCAACTGCAGGG - Intronic
996969893 5:129353258-129353280 CTGTAGTCACCCAAACAGCATGG + Intergenic
999723051 5:154412910-154412932 CTGTGTGCAGACACAAAGCACGG + Exonic
1000101415 5:158020744-158020766 CTGAAAACACACAGATAGCAAGG - Intergenic
1000805812 5:165790200-165790222 ATGAAAACAGACACACAGCATGG - Intergenic
1001224498 5:169932201-169932223 CTGCACACACACACAGAGTAAGG + Intronic
1001478337 5:172066822-172066844 CTGTGTTCACACACACAGTTAGG - Intronic
1002848939 6:974184-974206 ATATATACATACACACACCATGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004097012 6:12566390-12566412 ATATACACACACACACACCATGG + Intergenic
1004578889 6:16927931-16927953 ATATATACACACACACACCATGG - Intergenic
1005107804 6:22244319-22244341 ATATATACACACACATACCATGG + Intergenic
1005424906 6:25692510-25692532 CTGCATCCACACTCACAGCTGGG - Intronic
1005500258 6:26423066-26423088 CCTTATACACAAACACTGCAGGG - Intergenic
1005504725 6:26459614-26459636 CTTTATACACAAACACTGCGGGG - Exonic
1006211172 6:32396231-32396253 CCATATACACATGCACAGCAGGG + Exonic
1006338372 6:33432463-33432485 ATATACACACACACACAGCTTGG - Intronic
1006758143 6:36435671-36435693 CAATATACACACACACATCTTGG + Intronic
1007110047 6:39308254-39308276 ATGTGTACATACACACACCAAGG + Intronic
1007175395 6:39892870-39892892 CACTACACACACACACAGCAAGG + Intronic
1007872414 6:45055437-45055459 CTGTATTCACCAAAACAGCAGGG + Intronic
1008116147 6:47552504-47552526 GTATATATACACACACATCATGG - Intronic
1008171767 6:48216444-48216466 ATATACACACACACACACCATGG - Intergenic
1008698161 6:54066257-54066279 ATGTGCACACACACACAGCCAGG + Intronic
1009332148 6:62436915-62436937 CTGTAGTCACCCAAACAGCATGG - Intergenic
1010202547 6:73295548-73295570 CTTTAAAAACACACACAGCTGGG + Intronic
1010287352 6:74094593-74094615 CTGTATGCATACACACACCAGGG - Intergenic
1010369813 6:75094819-75094841 CTGTATAAACACTCAGAGCTGGG - Intronic
1010992198 6:82492160-82492182 CTCTATACACACAATTAGCAGGG - Intergenic
1013438028 6:110132895-110132917 ATATATACACAGACACACCATGG - Intronic
1013969078 6:115994444-115994466 CTGTTAACTCACACACAGCAGGG + Intronic
1014127431 6:117793257-117793279 CTGTTTCCATACACACAGCTTGG + Intergenic
1014132175 6:117846806-117846828 CTGGAAACACCCAGACAGCAGGG + Intergenic
1014334473 6:120115737-120115759 ATGTACACACAAACACATCATGG - Intergenic
1014350528 6:120338146-120338168 ACATATACACACACACACCATGG - Intergenic
1016146980 6:140689965-140689987 ATATATACACACACACACAAAGG + Intergenic
1016684858 6:146869653-146869675 CTGTATAAACATACACAGTGTGG - Intergenic
1017812706 6:157995659-157995681 ATGCACACACACACACAGCGGGG + Intronic
1019052854 6:169197074-169197096 ATGTGCACACACACACACCATGG + Intergenic
1019111236 6:169716524-169716546 CAGCACACACACACACACCATGG + Intronic
1019273529 7:164005-164027 CTGTCCAGACACACAAAGCAAGG + Intergenic
1019974648 7:4571010-4571032 ATATATACACACACACATAAAGG - Intergenic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1020348579 7:7192499-7192521 ATATACACACACACACACCACGG - Intronic
1020462121 7:8437511-8437533 CTGTGCTCACACACACGGCAAGG + Intronic
1020487856 7:8740886-8740908 CTACATACACACACACAAAATGG - Intronic
1021361564 7:19719384-19719406 GTGTATATACACACACACAATGG - Exonic
1021500477 7:21327932-21327954 CAAAACACACACACACAGCAAGG + Intergenic
1021833622 7:24644491-24644513 ATATACACACACACACACCATGG - Intronic
1022172890 7:27846308-27846330 ATGTATACACACACACACAATGG - Intronic
1022603746 7:31787662-31787684 TGGTTTACACACACAGAGCAAGG - Intronic
1022870817 7:34477666-34477688 CTGAATAAACATCCACAGCAGGG + Intergenic
1023033076 7:36107966-36107988 CTGTGTACAGACACTCAGCCAGG + Intergenic
1023722604 7:43112363-43112385 CTGTTTGCACACACACAAAAGGG + Intergenic
1024283854 7:47740198-47740220 ATGTGTACACACACACACAATGG + Intronic
1024790599 7:52960947-52960969 ATATACACACACACACACCATGG - Intergenic
1025857367 7:65294031-65294053 ATATATACACACACACACTATGG - Intergenic
1026486656 7:70827787-70827809 GTATATACACACACACACCATGG + Intergenic
1027268066 7:76504847-76504869 CTGTCTTCACACCCACACCACGG - Intronic
1027878219 7:83799262-83799284 ATAAATACACACACACATCATGG + Intergenic
1029463091 7:100707420-100707442 CCGCATACACACACTCAGGAAGG - Exonic
1030627063 7:111855782-111855804 CTGTAAACAGACAGAGAGCAGGG + Intronic
1030808652 7:113947232-113947254 ATATACACACACACACACCATGG - Intronic
1031434360 7:121713852-121713874 ACGCATACACACACACAGCTAGG - Intergenic
1032099960 7:128967102-128967124 ATGTACATACATACACAGCATGG + Intronic
1033169196 7:139068510-139068532 CTGTATAGCCACACATAGCTTGG - Intronic
1033891759 7:146021491-146021513 ATATATACACACACACATAAAGG + Intergenic
1034261189 7:149756959-149756981 ATGTATATACACACACCCCAAGG - Intergenic
1034677187 7:152900413-152900435 CTGGACACAGACACCCAGCAGGG - Intergenic
1035263952 7:157679068-157679090 ATGTACACACACACACACTAAGG - Intronic
1035646618 8:1227226-1227248 TTTTATACACACACACAGAATGG + Intergenic
1035651695 8:1270823-1270845 CTGTAGACACACACACAGAGAGG - Intergenic
1035724635 8:1816962-1816984 CTGCAGACACACCCACCGCACGG + Intergenic
1036618187 8:10404673-10404695 ATGTGTACACAAACACAGCCCGG + Intronic
1036753199 8:11456093-11456115 ATTCACACACACACACAGCAAGG - Intronic
1036753204 8:11456130-11456152 ATTCACACACACACACAGCAAGG - Intronic
1036753211 8:11456167-11456189 ATTCACACACACACACAGCAAGG - Intronic
1037178875 8:15979622-15979644 GTGTATACACACACACACAATGG - Intergenic
1038127825 8:24693825-24693847 CTGTCTACCCACTCACACCATGG - Intergenic
1038208261 8:25490196-25490218 ATATATACACACACACACGAAGG - Intronic
1039087167 8:33791469-33791491 ATATACACACACACACATCATGG + Intergenic
1039752640 8:40492417-40492439 CTCTACACACACACACAAAAAGG - Intergenic
1039975803 8:42363878-42363900 CTGTATAAACACCAACAGGAAGG + Intronic
1040042042 8:42926168-42926190 CTATATACACACACACATTTAGG - Intronic
1040867505 8:52064281-52064303 ATATACACACACACACACCATGG + Intergenic
1041245232 8:55882499-55882521 ATGTATACATGCCCACAGCAGGG + Intronic
1041273661 8:56134933-56134955 CTGTAGACAAAGACAAAGCAAGG - Intergenic
1041289934 8:56299034-56299056 CTCTCCACACACACACACCAAGG + Intergenic
1042525962 8:69765212-69765234 ATATATACACACACACACAATGG + Intronic
1043202164 8:77383892-77383914 ATATATATACACACACACCATGG + Intergenic
1043537308 8:81219880-81219902 ATATATATATACACACAGCATGG - Intergenic
1044957918 8:97500759-97500781 ATATATACACACACACACCATGG - Intergenic
1046344956 8:112911614-112911636 ATGTACACACACACACACAATGG - Intronic
1046530093 8:115434116-115434138 ATGTATATACATACACACCAAGG - Intronic
1047219933 8:122911098-122911120 CGGTCTACACACACGCAGGATGG + Intronic
1047499409 8:125430258-125430280 CTGTATACACACACACTCACAGG - Intergenic
1047606842 8:126483102-126483124 ATATATACACACACACACCACGG - Intergenic
1048113806 8:131497506-131497528 ATTTATACACACACACAACATGG - Intergenic
1048693781 8:137000413-137000435 ATATATACACACACACACCATGG - Intergenic
1049695045 8:143979283-143979305 GTTTACACACACACACAACAAGG + Intronic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1050422724 9:5483832-5483854 ATATATACACACACACAGGTAGG + Intergenic
1050894923 9:10874228-10874250 ATATATACACAAACACAGCTGGG + Intergenic
1050977078 9:11952343-11952365 ATGTATACACTCACGAAGCAAGG - Intergenic
1051388558 9:16539040-16539062 TGGTAAACACACACACACCATGG - Intronic
1051718881 9:20014512-20014534 ATATATACACACACACACAATGG + Intergenic
1052666426 9:31500487-31500509 CTGTACACACACATACACAATGG + Intergenic
1052869083 9:33485908-33485930 ATATATACACACACACAATAAGG - Intergenic
1055186699 9:73465034-73465056 ATATATACACACACACACCATGG - Intergenic
1055207800 9:73753307-73753329 ATATATACACACACACACAATGG + Intergenic
1055880345 9:80993838-80993860 ATATACACACACACACAACAGGG - Intergenic
1057093315 9:92280770-92280792 CTGGATTAACACACACAGCAAGG + Exonic
1057246450 9:93459149-93459171 CTGGGAATACACACACAGCATGG + Intronic
1057727117 9:97575510-97575532 CTGTTTACACACCCCCAGGATGG - Intronic
1058157057 9:101527839-101527861 CTGTATACACACAGCAAGGAGGG - Intronic
1058764922 9:108173003-108173025 CTATAGTCACACAAACAGCATGG - Intergenic
1058984400 9:110197808-110197830 CTGTGTAAACACAGACAGAAGGG + Intronic
1059088602 9:111332395-111332417 ATACATACACACACACACCATGG + Intergenic
1061329590 9:129884166-129884188 CTGTCTACAGGCACTCAGCATGG - Intergenic
1062227456 9:135460881-135460903 AAGTACAGACACACACAGCATGG - Intergenic
1062270396 9:135705643-135705665 CCTTATCCACACACACAGCTGGG - Intronic
1185633359 X:1534280-1534302 ATATATACACACACACAGATAGG + Intronic
1185706355 X:2270196-2270218 CTGTGTACACAAACACAGGCAGG - Intronic
1185886780 X:3790194-3790216 CTGTGTACACCCGCCCAGCAGGG - Intergenic
1186992824 X:15087923-15087945 TTGTATAAACAAACACAGCTGGG - Intergenic
1187585469 X:20656499-20656521 CTGTATACATACACGCATAATGG - Intergenic
1187909759 X:24100812-24100834 CTGTATACACAGTCTCAGCCAGG + Intergenic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1188706771 X:33343316-33343338 ATATATACACACACACACAACGG + Intergenic
1188952395 X:36392394-36392416 CTGTATCCAGACATCCAGCAGGG + Intergenic
1189150914 X:38705575-38705597 CTGAGTACACACACACAAAATGG + Intergenic
1190710980 X:53070019-53070041 GTGTATACACACACATGGTAGGG + Intronic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1191598016 X:62969314-62969336 CTGTATATACACTCACCACAAGG + Intergenic
1191688533 X:63916890-63916912 ATGTATACATACCCTCAGCAAGG + Intergenic
1192690780 X:73361172-73361194 ATATATACACACACACACCATGG - Intergenic
1192722640 X:73715816-73715838 ATATATACACACACACAGAGTGG - Intergenic
1192852830 X:74975818-74975840 ATATACACACACACACACCATGG - Intergenic
1193982389 X:88198969-88198991 ATGCACACACACACACACCATGG + Intergenic
1194587881 X:95759066-95759088 TTATATACACACACACACCATGG + Intergenic
1194623419 X:96200652-96200674 TTGTATGCACACACACACAATGG + Intergenic
1194878591 X:99221023-99221045 GTATACACACACACACACCATGG + Intergenic
1195002967 X:100659884-100659906 AAGGATGCACACACACAGCATGG - Intronic
1195386152 X:104315039-104315061 CTGTATTCACACAGAGAGAAGGG - Intergenic
1196031917 X:111100954-111100976 CACTATACAGACACACAACATGG + Intronic
1197130487 X:123000131-123000153 CTGCACACACACATACACCATGG + Intergenic
1197261752 X:124327348-124327370 CTATAAAAACATACACAGCAAGG + Intronic
1198039807 X:132839330-132839352 GTATATACACACACACACCGTGG + Intronic
1198559386 X:137832263-137832285 ATATATACACACACACATCATGG - Intergenic
1200483929 Y:3744157-3744179 GTGTATATACATACACACCATGG - Intergenic
1200946471 Y:8845365-8845387 CTGTAAACACTGACACATCATGG + Intergenic
1201319451 Y:12681950-12681972 ATGCATACACACACACATCCTGG - Intergenic
1201747923 Y:17400140-17400162 ATATATACACACACACACAAAGG - Intergenic