ID: 1087879850

View in Genome Browser
Species Human (GRCh38)
Location 11:103403208-103403230
Sequence GGGTAGACCTAGAAATGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087879850 Original CRISPR GGGTAGACCTAGAAATGTTG GGG Intronic
900056329 1:633727-633749 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
901117332 1:6857849-6857871 GGGGAGATCTAGGGATGTTGAGG + Intronic
903584544 1:24401536-24401558 GGGTAAACTGAGAAATGGTGTGG + Intronic
903734497 1:25521771-25521793 GTGGAGACCAAGAAATGCTGGGG + Intergenic
905199979 1:36308579-36308601 GGGTGGACCTAGACATGTGGGGG + Intronic
908699966 1:66888342-66888364 GGGTAGAAGTAGAATTGTTTAGG + Intronic
912146735 1:106803374-106803396 AGGTAGAACTAGAATTGTTGGGG + Intergenic
916386146 1:164272702-164272724 GGGCAGACCTAGAAGTGTTCTGG + Intergenic
919050791 1:192508781-192508803 GCATAGGACTAGAAATGTTGTGG - Intergenic
922632532 1:227130987-227131009 CAGTAGACCTAGGAATTTTGAGG - Intronic
1066762908 10:38773502-38773524 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1068945043 10:62721302-62721324 TGGTACACCTTGAAATGATGTGG + Intergenic
1069584663 10:69590302-69590324 GGGTAGGCCTAGTATTGTTGGGG + Intergenic
1070649807 10:78227038-78227060 GGGTGGTGCTAGAAATGTTAGGG + Intergenic
1072975913 10:100057616-100057638 GGGTAGGCCTAGTACTGTAGGGG + Intronic
1074247578 10:111710320-111710342 GAGAAGACCAAGAAATGTGGTGG + Intergenic
1074925779 10:118069030-118069052 GGGTAAAGCTGGAAATGGTGAGG - Intergenic
1077487628 11:2846356-2846378 GGAAAGACCTAGAAGTGGTGGGG - Intronic
1078962943 11:16300757-16300779 ATGTAGATCTAGAAGTGTTGAGG - Intronic
1080434702 11:32228926-32228948 GGGTAGCGATAGAAATGTTTTGG + Intergenic
1083743747 11:64723861-64723883 GGGTAGACCTAGGAACTTGGGGG + Intergenic
1087879850 11:103403208-103403230 GGGTAGACCTAGAAATGTTGGGG + Intronic
1092962679 12:13611104-13611126 AGGTAGACCTAGAGATGTGAGGG - Intronic
1102000294 12:109553473-109553495 GCGGAGACCTAGAAACTTTGGGG - Intergenic
1106611697 13:31289231-31289253 GTGTAGTCCTAGACATCTTGAGG - Intronic
1108130154 13:47290260-47290282 GGGTAGAAGTAGAAGTGTGGGGG + Intergenic
1108334376 13:49423839-49423861 TTGTAGACCTAGAAAAGTTAAGG + Intronic
1108373606 13:49793559-49793581 TGGTAGAACAAGAAGTGTTGGGG - Intergenic
1110942802 13:81370953-81370975 GGGCAGACCTAGAAACTTTTAGG + Intergenic
1114432162 14:22670949-22670971 GGGTATATCTAGAAATGTCTGGG - Intergenic
1120718712 14:87867768-87867790 TGGTAGATCTAGACATTTTGAGG - Intronic
1202934236 14_KI270725v1_random:69756-69778 GGGTTTACCTAGGAATGTTTAGG - Intergenic
1123775992 15:23580717-23580739 GGGCTGACCTGGAAATATTGTGG + Intronic
1126749017 15:51857176-51857198 GGGCAGATCTAAAACTGTTGAGG + Intronic
1129065344 15:72899123-72899145 GGTCAGACATAGAAATGGTGGGG - Intergenic
1129846558 15:78770517-78770539 GGGGAGACCAAGGAATGGTGGGG + Intronic
1133154892 16:3866699-3866721 GGGTTGAGCTAGAGATGTTTTGG - Intronic
1133993017 16:10725243-10725265 GAGTAGACCTAGGATTGTCGGGG + Intergenic
1146660216 17:34660594-34660616 GGGAAGACCTAAGAATGCTGAGG + Intergenic
1146973378 17:37090936-37090958 GGGTAAATCTAAAAATCTTGGGG - Intronic
1152790298 17:82275015-82275037 GAGAAGAGCTAGAAATGTTGGGG - Intergenic
1153681682 18:7507150-7507172 GGGTAGGACTAGGAAAGTTGGGG + Intergenic
1155472606 18:26206475-26206497 GGTCAGACATAGAAATGGTGGGG + Intergenic
1155800859 18:30101983-30102005 GGGTATAACTATAGATGTTGGGG + Intergenic
926855545 2:17252068-17252090 GGGGAGACCTAGGACTGTTTGGG + Intergenic
929737049 2:44561235-44561257 GGTAAGACGTAGTAATGTTGAGG - Intronic
933983710 2:87573822-87573844 GGGTAGACCAGGGAAGGTTGGGG + Intergenic
934011512 2:87825134-87825156 GGGCAGACCTAGGATTGTGGGGG - Intronic
934307021 2:91834577-91834599 GGGTTCACCTAGGAATGTTTAGG + Intergenic
934326235 2:92018165-92018187 GGGTTCACCTAGGAATGTTTAGG - Intergenic
936310141 2:111376972-111376994 GGGTAGACCAGGGAAGGTTGGGG - Intergenic
937202225 2:120211085-120211107 GGGTAGACCTAGAATTGTTGGGG - Intergenic
937530972 2:122827271-122827293 GGGAAGACTTAGAAATTTTCAGG - Intergenic
938309267 2:130276538-130276560 GGGTAACCCTAGGATTGTTGGGG - Intergenic
938446228 2:131381537-131381559 GGGTAACCCTAGGATTGTTGGGG + Intergenic
938969508 2:136419295-136419317 GGATCGACCAAGAAAGGTTGAGG + Intergenic
939271326 2:139943848-139943870 GGGCAGACCTATAAATCTAGTGG + Intergenic
939299152 2:140311475-140311497 GTGTACACGTAGACATGTTGTGG + Intronic
939510672 2:143100559-143100581 GGGTAGGCCTAGAATTGTTGGGG + Intronic
944741342 2:202615795-202615817 AGGTAGACCTAGAATTGTCGGGG - Intergenic
945211988 2:207393075-207393097 GGGTTGAATTAGAAATGTTGGGG - Intergenic
945671470 2:212807252-212807274 TGGCAAACCTGGAAATGTTGTGG + Intergenic
948269462 2:236663151-236663173 GGGCAGGTTTAGAAATGTTGGGG + Intergenic
1172042167 20:32053001-32053023 GGTTTGACCTAGACCTGTTGTGG - Intronic
1176595638 21:8691958-8691980 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1180278497 22:10669068-10669090 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1180585748 22:16887927-16887949 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1185201627 22:49509532-49509554 AGGAATACCTAGAAATGTGGTGG - Intronic
949253602 3:2018693-2018715 GGATAAAACTAGAAATGTAGTGG + Intergenic
952844288 3:37674093-37674115 TAGGAGACATAGAAATGTTGTGG + Intronic
956941788 3:74170508-74170530 AGGAAGACCAAGAAATGTAGGGG + Intergenic
958143001 3:89587589-89587611 AGGTAGACCTAGAATTGTCAGGG + Intergenic
966918401 3:184597296-184597318 GGTGAGACCTAGAAAGCTTGAGG - Intronic
971783447 4:31068972-31068994 GCTTTGTCCTAGAAATGTTGAGG + Intronic
975557986 4:75683118-75683140 GGTTACACCTAGAAATGTGTGGG - Intronic
978675477 4:111309617-111309639 GGGAAGCCCTGGAAAAGTTGGGG + Intergenic
978750346 4:112239113-112239135 GGGTAGAACTACAAATATAGAGG - Intronic
979717232 4:123854650-123854672 TGGTACACCGACAAATGTTGAGG + Intergenic
981732060 4:147909953-147909975 CAGTAGTCCAAGAAATGTTGAGG - Intronic
982443009 4:155458587-155458609 GGGTAGGCCTAGAATTGTCGGGG + Intergenic
988341459 5:29977399-29977421 GGCTACACCTAGAACTGCTGGGG - Intergenic
989035165 5:37163200-37163222 GGATATACCTAGTAATGGTGAGG + Intronic
990826761 5:59909110-59909132 GATAAGACCTAGAAATGTTTGGG - Intronic
994459456 5:100053891-100053913 GGGTAGTCCGAGTAACGTTGGGG + Intergenic
996851204 5:127954705-127954727 GAGTAGACCTATAAATATTAAGG + Intergenic
1000597221 5:163229968-163229990 GGGTAGACCCAAGAATGTGGTGG - Intergenic
1004622172 6:17340585-17340607 GAGTAGACCTAAAAATGCTAGGG + Intergenic
1007872647 6:45058732-45058754 GGCTAGAGCTAAAAATGATGGGG - Intronic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1011945123 6:92890899-92890921 GGGTAGGCCTGGACCTGTTGTGG + Intergenic
1013760891 6:113516181-113516203 GGTTAGACCCAGAAATTTAGAGG - Intergenic
1014134371 6:117871182-117871204 GGGTATTCCAAGAAATGCTGTGG + Intergenic
1014222556 6:118812530-118812552 GGTTAGGCCTGGAAATGTTTTGG - Intergenic
1014379123 6:120716450-120716472 GTGTAGGTCTTGAAATGTTGAGG - Intergenic
1017020836 6:150138879-150138901 GGGAAGACCTAGAGACGTGGGGG + Intergenic
1017670016 6:156761982-156762004 TGGTAGTCCTAGATATGCTGTGG + Intergenic
1022560388 7:31342340-31342362 GGACAGTTCTAGAAATGTTGGGG + Intergenic
1023361166 7:39416551-39416573 GGGTGGATCTAGAAATGTGTGGG - Intronic
1025730997 7:64107519-64107541 GGGTAAACCTAGGATTGTCGGGG + Intronic
1026114270 7:67483194-67483216 GGGAAGACCTGGAGATGGTGAGG - Intergenic
1026328293 7:69330142-69330164 AGGTAGACCTAGAATTGTTGGGG + Intergenic
1028489886 7:91399496-91399518 GAGTAGAGCTAGAGAGGTTGTGG - Intergenic
1031494519 7:122430227-122430249 TGGTGAACCTAGAAATGTGGAGG - Intronic
1031808663 7:126338676-126338698 AGTCAAACCTAGAAATGTTGAGG + Intergenic
1032612877 7:133434581-133434603 GGGTGGACTGAGAAATGTAGAGG + Intronic
1032700781 7:134377274-134377296 GGGCAGAGGTAGAAATGTGGTGG + Intergenic
1034197599 7:149260341-149260363 TTTCAGACCTAGAAATGTTGAGG + Intergenic
1035345214 7:158192913-158192935 GGGTAGACCAAGGAAGGTGGCGG + Intronic
1038956842 8:32477176-32477198 GTGTAGACCTTGAAAAGCTGAGG - Intronic
1041748893 8:61237781-61237803 GGTCAGACCAAGAAAGGTTGGGG + Intronic
1042331808 8:67588352-67588374 GGGTAGGCCTAGAATTATTGGGG + Intronic
1042820330 8:72923283-72923305 GGGGAGACCTAGAAATGGAAAGG + Intronic
1047749360 8:127868181-127868203 GGGAAGACCTAGAGAGGTTAGGG + Intergenic
1048900754 8:139035131-139035153 GATTAAACCTCGAAATGTTGGGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1053694677 9:40625545-40625567 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1054270160 9:63014571-63014593 GGGTTCACCTAGGAATGTTTAGG + Intergenic
1054305921 9:63424769-63424791 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1054404667 9:64748751-64748773 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1054438290 9:65234243-65234265 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1054492114 9:65787705-65787727 GGGTTCACCTAGGAATGTTTAGG + Intergenic
1054943057 9:70764868-70764890 GGGGAGATCTACAAGTGTTGGGG - Intronic
1055768403 9:79690232-79690254 GGGTAGACCTGGAACTGCTTGGG - Intronic
1062058433 9:134481545-134481567 AGGAATACCTAGAAGTGTTGGGG - Intergenic
1202629986 M:8558-8580 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
1188851790 X:35141199-35141221 TGGTGAACCTAGAAATGTGGAGG + Intergenic
1189110214 X:38281771-38281793 GTGGACACCTAGAAAAGTTGTGG - Intronic
1189256660 X:39645177-39645199 GGGAAAACCTAGAAAAGTTTCGG + Intergenic
1194604797 X:95965234-95965256 GAATAGACCCAGAAATGTTAAGG - Intergenic
1201192488 Y:11457493-11457515 GGGTTCACCTAGGAATGTTTAGG - Intergenic
1201866483 Y:18661127-18661149 GGGTTGGCCCAGAGATGTTGAGG + Intergenic