ID: 1087879957

View in Genome Browser
Species Human (GRCh38)
Location 11:103404518-103404540
Sequence CAGGATAATCAGAGTAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087879954_1087879957 14 Left 1087879954 11:103404481-103404503 CCTACTGATGAGATAATATTTCA 0: 1
1: 3
2: 7
3: 30
4: 232
Right 1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG 0: 1
1: 0
2: 2
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087879957 Original CRISPR CAGGATAATCAGAGTAATGT TGG Intronic
900056161 1:632385-632407 CGGGATAGTCCGAGTAACGTCGG - Intergenic
901898011 1:12331224-12331246 CAGAATAATCAGAGTAGTGCTGG + Intronic
903797969 1:25944531-25944553 GAGGATAATCAGAGAAAAATAGG + Intergenic
910382734 1:86645986-86646008 CAGAGTAATCAGAGTACTTTCGG + Intergenic
910878957 1:91905171-91905193 CAGAATAATCCTATTAATGTTGG + Intronic
913240270 1:116824281-116824303 CAGGATTATAAAAGTAATGGAGG - Intergenic
913283203 1:117204930-117204952 TGGGATAATCAGAATAAAGTAGG - Intronic
918343737 1:183588784-183588806 CAGGAGAAACAGAGACATGTGGG + Intronic
919327674 1:196129566-196129588 AAGGAAAATCAGAGAAATGTGGG + Intergenic
920493843 1:206440033-206440055 CATGATAATCAGAGTGGTTTTGG - Exonic
920896379 1:210054740-210054762 CAGGATAATGAGGATAATGGAGG - Intronic
923473721 1:234313981-234314003 CAGGGTATTGAGAGTAAGGTAGG + Intronic
923867887 1:237960180-237960202 CAGAACATTCAGAGTCATGTAGG - Intergenic
1064728019 10:18300917-18300939 CAGAATATTCAGAGTACTCTGGG + Intronic
1069095518 10:64254536-64254558 GGAGATACTCAGAGTAATGTGGG + Intergenic
1072302020 10:94070918-94070940 CAGGAGAAGCGGATTAATGTTGG - Intronic
1073506878 10:104002877-104002899 GAGGATACGCAGAGTAATGATGG + Exonic
1077912116 11:6580974-6580996 CAGCATAATCACAGTGATGGTGG + Intronic
1078229501 11:9426849-9426871 CAGGAGAATCACTTTAATGTGGG - Intronic
1079109634 11:17597526-17597548 CAGTTTATTCAGAGTAATGGTGG + Intronic
1080941931 11:36928278-36928300 AAGGATGAACAGAGTAATGCTGG - Intergenic
1082134010 11:48526784-48526806 CAGGACAGTCACGGTAATGTGGG - Intergenic
1082138643 11:48580152-48580174 CAGGACAACCACGGTAATGTGGG - Intergenic
1082567028 11:54693170-54693192 CAGGACAACCACGGTAATGTGGG - Intergenic
1082625394 11:55478325-55478347 GAGGACAACCACAGTAATGTGGG - Intergenic
1084999592 11:73018617-73018639 CATTAGAAACAGAGTAATGTAGG - Intronic
1086398361 11:86440563-86440585 AAGGAAAACCAGAGAAATGTGGG - Intergenic
1086877293 11:92112047-92112069 CTGGTTAGCCAGAGTAATGTAGG - Intergenic
1087157295 11:94917963-94917985 CAGGAACAACAGAGTATTGTAGG + Intergenic
1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG + Intronic
1090815868 11:130294750-130294772 CAGGTTAATCAGAGTACTTAAGG + Intronic
1090979755 11:131709157-131709179 CAGGATAATAAGAGTAAGGTGGG + Intronic
1091156221 11:133376716-133376738 TTGGATAAACAGAGTAATTTGGG + Intronic
1094069496 12:26397307-26397329 CAGGATAAGCAAAGTCATGGAGG - Intronic
1094157143 12:27349078-27349100 GAGGAGAATCAGAGTCATGGGGG + Intronic
1095552168 12:43455799-43455821 TAGGATAATCACATGAATGTGGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097152438 12:56988803-56988825 CAGGATAAAAACAGCAATGTTGG - Intergenic
1099169408 12:79345691-79345713 CAGGAGTATGAGAGTAATGCAGG + Intronic
1099517725 12:83618859-83618881 CAGGAAAATCTAAGAAATGTAGG + Intergenic
1101357222 12:103991731-103991753 CAGGAAAATCAGAGGATTCTGGG + Intronic
1106278812 13:28243779-28243801 CAGGAGAATCACTGTAATCTGGG - Intronic
1106633666 13:31504462-31504484 CAGGAAACTCAGAATAATGGCGG - Intergenic
1107315901 13:39131632-39131654 CAGGACAATGAAAGTAATGAGGG - Intergenic
1107685025 13:42888223-42888245 AAGTATAATTAGAGTGATGTTGG - Exonic
1108145227 13:47469831-47469853 CAGGACAAACAGAGTAGTGTGGG + Intergenic
1108787777 13:53926736-53926758 CAGAAAAATCAAATTAATGTAGG - Intergenic
1113220250 13:108092588-108092610 CAAGTTGATGAGAGTAATGTAGG + Intergenic
1113423971 13:110192694-110192716 AAGCATAATCAGAAGAATGTTGG - Intronic
1115447126 14:33503791-33503813 AAGGATAAACAAAGCAATGTAGG - Intronic
1118825705 14:69378883-69378905 CAGGACAATCAGATTACTTTTGG + Intergenic
1119882081 14:78107584-78107606 CAGGATAATCTGAGGACAGTGGG + Intergenic
1120794946 14:88622459-88622481 CAGCAAAGACAGAGTAATGTTGG + Exonic
1124198108 15:27651008-27651030 CAGGATGATCAGAGTTCTGGAGG + Intergenic
1124582077 15:30965690-30965712 CAGGATATTCACAGAAGTGTTGG + Intronic
1126124795 15:45285477-45285499 CAACAGAATCAGGGTAATGTAGG + Intergenic
1130561706 15:84964082-84964104 CAGGAGAATCAGGGTGCTGTGGG - Intergenic
1131110259 15:89760460-89760482 CCAGATAATCAGATTATTGTGGG - Intergenic
1131865313 15:96702572-96702594 CAGGATACACAGAAAAATGTAGG - Intergenic
1132161839 15:99549852-99549874 CAAGAAAATCAGGGAAATGTAGG - Intergenic
1139091284 16:63651072-63651094 CAGGAGAATCACTGTAATGTGGG - Intergenic
1140131840 16:72169094-72169116 CATGAAAATCGGAGTAATTTTGG + Intronic
1143915175 17:10286362-10286384 CAGGATCAGCATAGTAGTGTGGG + Intergenic
1150385249 17:64754029-64754051 CAGGATAACCAGAATAATCTTGG + Intergenic
1150771403 17:68044457-68044479 CAGGATAACCAGAATAATCTTGG - Exonic
1150991196 17:70261164-70261186 CAGGAGAATCATAGTGATGGTGG + Intergenic
1151862073 17:76771779-76771801 CAGGTTGATCAGAGTAACCTGGG + Intronic
1153464833 18:5377879-5377901 CAGGAAAAGCAGAGAAAGGTGGG + Intergenic
1153544631 18:6193240-6193262 AATGAAAATCAGAGTCATGTTGG + Intronic
1156056120 18:33005662-33005684 CATAATAATCAGAGTAAATTAGG - Intronic
1156166833 18:34431609-34431631 ATGGAAAATCTGAGTAATGTTGG - Intergenic
1157005645 18:43580514-43580536 CAGGAAATTCAGAGTTATTTTGG - Intergenic
1159560553 18:69988377-69988399 CATTATAATCAGAGTCATGAAGG + Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1164690247 19:30205485-30205507 CAGGAGAATCACTGGAATGTGGG + Intergenic
1166104993 19:40593571-40593593 CAGGATATTCAGAATATTGGGGG + Intronic
1167212823 19:48144114-48144136 CAGGAGAGTCAGAGGAAAGTGGG + Intronic
925755664 2:7129530-7129552 CAGGAAAACTATAGTAATGTAGG + Intergenic
932169415 2:69539991-69540013 CAAGATATTCAAAGTATTGTTGG - Intronic
935644730 2:105324912-105324934 CAGGATTCCCAGATTAATGTCGG - Intronic
938183349 2:129205399-129205421 CAGGATAATCAGGTTTTTGTAGG - Intergenic
939787778 2:146538252-146538274 CAGGATTATTAGAGTTAGGTTGG + Intergenic
940687343 2:156869498-156869520 CAGAACAATAATAGTAATGTTGG + Intergenic
940885730 2:158987964-158987986 GAGGAAAATTAGAGTAAGGTAGG - Intronic
941184743 2:162308088-162308110 CAGCATAAACAGACTACTGTAGG - Intronic
941571057 2:167171613-167171635 CAGAATAAGCAGACTAATATCGG - Intronic
942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG + Intergenic
942433496 2:175943400-175943422 CAGAGTTATCAGAGTTATGTCGG - Intronic
943417471 2:187626592-187626614 CAGAATAGTCTGAGGAATGTAGG - Intergenic
943469202 2:188272569-188272591 CAGAATAACCAGAGAAATATTGG + Intergenic
943471801 2:188303744-188303766 CAAGTCAATCACAGTAATGTAGG - Intronic
943678440 2:190741687-190741709 CAGTATATTCAGAGAAATCTAGG + Intergenic
943954645 2:194173437-194173459 CAGGGTAAATAGAGTAAGGTAGG - Intergenic
944023353 2:195133524-195133546 TAGAAAAATCAGAATAATGTTGG + Intergenic
944179754 2:196877736-196877758 CAAAATAATCAGAAAAATGTAGG - Intronic
945507504 2:210659412-210659434 AAGGATAATCAGAGTCTGGTAGG - Intronic
1170738224 20:19028712-19028734 CAGGATAACCTGAGTCATCTTGG - Intergenic
1173081898 20:39876387-39876409 CACCATAACCAGGGTAATGTGGG + Intergenic
1177598215 21:23274811-23274833 CAGGAGAATCACTGGAATGTGGG + Intergenic
1178939781 21:36895538-36895560 GAGGATTATCAGAGCAATGGGGG - Intronic
1179186892 21:39091653-39091675 CAGAGTAATCAGAGTAATCAGGG - Intergenic
1181792890 22:25282126-25282148 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1181813529 22:25420464-25420486 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1182919731 22:34068347-34068369 TAGGAAAATCAGTGTTATGTGGG - Intergenic
1184028652 22:41877638-41877660 CAGGGTATTTAGAGTAGTGTGGG - Intronic
949151319 3:771121-771143 AAGAATATTCAAAGTAATGTTGG + Intergenic
950198325 3:11025474-11025496 CAGGATGATCAGCATGATGTAGG - Exonic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952683776 3:36125527-36125549 CAGAATACTCAGTGTAATGGTGG + Intergenic
953987231 3:47453734-47453756 CATGAATATCACAGTAATGTTGG + Intronic
955816834 3:62852633-62852655 CAGGAAATTCAGAGTAAACTGGG - Intronic
957252282 3:77788376-77788398 CAGGATAATGAAGGTAATGCTGG - Intergenic
960067938 3:113395093-113395115 CAGGATTATTGGAGTAACGTTGG - Intronic
960580817 3:119277171-119277193 CAGGACTATCTGAGCAATGTGGG + Intergenic
964130709 3:153282952-153282974 CAGAATAATCAGTGTCATGAAGG + Intergenic
964307766 3:155359100-155359122 CAGCCCAAGCAGAGTAATGTAGG + Intergenic
966389323 3:179435274-179435296 AAGGATAATCAGAGAAGTATGGG - Intronic
966556660 3:181269472-181269494 CTGAATAATGAGAGTTATGTTGG + Intergenic
967533297 3:190573618-190573640 CAGGATATTTAGAGTAATAAAGG - Intronic
967541183 3:190669423-190669445 CAAGATAATCAGACTAGAGTGGG + Intergenic
971510926 4:27422305-27422327 CACGATAATCAGAATGATCTGGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
971815582 4:31483864-31483886 CAGGAGAATCACTGGAATGTGGG + Intergenic
972278942 4:37585083-37585105 CAGGATAAACAAAGTATTGCAGG + Intronic
972827777 4:42780925-42780947 AGGGATACTCAGAGTTATGTGGG + Intergenic
975974633 4:80080833-80080855 CAGGATAACCAGAATAACCTTGG - Intronic
978765426 4:112400441-112400463 CAGGAGAATTAGAGGAATTTTGG + Intronic
980753777 4:137129182-137129204 GAGGATGATCAGAATTATGTAGG - Intergenic
982353461 4:154442355-154442377 CAGGATATACAGAGCCATGTAGG - Intronic
984375556 4:178924322-178924344 CAGGACAATCAGAGAACTGATGG + Intergenic
986803190 5:11282625-11282647 TAGGATAATCTAAGTAATGTTGG - Intronic
991560633 5:67947800-67947822 CTGGATACTGAGATTAATGTTGG - Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
998164103 5:139832236-139832258 CAGGATTATGAGGGCAATGTTGG - Intronic
998970400 5:147585031-147585053 CAGGGCTATCAGTGTAATGTAGG - Intergenic
999512020 5:152262257-152262279 CAAGGTAATGAGAGTGATGTGGG + Intergenic
1001298398 5:170515454-170515476 CTGGAAAATTAGAGTTATGTTGG + Intronic
1003159193 6:3620920-3620942 CAGGATAATCAGATAAAATTGGG + Intergenic
1003602312 6:7528859-7528881 CAGGATAATCAGTGTCATGAAGG + Intergenic
1003828710 6:9981017-9981039 CAGGATCATCAGAGAAAAATGGG - Intronic
1004229128 6:13814833-13814855 TAGGATAATCAGTGAAATCTAGG - Intergenic
1004447763 6:15716436-15716458 CAGGATATTCTGAGTAAACTGGG - Intergenic
1007508101 6:42352894-42352916 CACGATAATCTTAGCAATGTTGG - Intronic
1008616346 6:53230146-53230168 TAGGATAATCAGAGGACTGGGGG - Intergenic
1012260850 6:97085710-97085732 CAGGAGAATCAGAGTAAATTTGG + Intronic
1016491344 6:144607509-144607531 CAAGATTATCAGTGAAATGTTGG - Intronic
1017502157 6:155035531-155035553 CACGAGACTCAGACTAATGTTGG + Intronic
1018225850 6:161628046-161628068 CATGTCAATTAGAGTAATGTTGG + Intronic
1020362845 7:7348191-7348213 GAGGACAATGAGAGTAAAGTTGG + Intergenic
1021495481 7:21269664-21269686 TAAGATAATTAGAGTCATGTAGG - Intergenic
1028253574 7:88564991-88565013 CAGGATAACCAGAATAAACTTGG + Intergenic
1028941167 7:96523537-96523559 AACGATGATCAGAGTGATGTGGG - Intronic
1033818577 7:145106143-145106165 CAAGATAAACACAGAAATGTAGG + Intergenic
1035393332 7:158519908-158519930 CAGGCTAATGATAGTAAAGTTGG - Intronic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1036716338 8:11127681-11127703 CAGGATTATCTGGGTAAGGTGGG - Intronic
1037938589 8:22932040-22932062 CAGGATACTGAGAGTAGAGTGGG - Intronic
1039359607 8:36861703-36861725 CGGGATAATCTGAATAATATAGG + Intronic
1042239048 8:66644254-66644276 CTGTTTAATCAGGGTAATGTTGG - Intronic
1044364224 8:91324478-91324500 CAGAATAATCAGAATAATCTGGG + Intronic
1047518745 8:125578195-125578217 CAGGACTATCAGACTCATGTTGG + Intergenic
1047853933 8:128889483-128889505 AAGGGTAATGAGAGTTATGTTGG + Intergenic
1058650323 9:107169832-107169854 CAGGATAACCAGAATAACCTTGG + Intergenic
1186526041 X:10249292-10249314 CAGGATGGTCAGAATCATGTTGG - Intergenic
1187500717 X:19836293-19836315 CAGGGAAAACAGAGTAATTTAGG + Intronic
1188653463 X:32660854-32660876 CAGCAAAATCAGAGTAACCTAGG - Intronic
1188912105 X:35862273-35862295 CAGCTTAATAAGTGTAATGTAGG - Intergenic
1189703793 X:43739266-43739288 CAGGATAGTCAGAGGAAGTTTGG - Intronic
1190415690 X:50178418-50178440 CAGAATCATCAGAGTGCTGTTGG - Intergenic
1190865085 X:54377611-54377633 CAGGATAATCAGTTGAATCTGGG + Intergenic
1191947338 X:66550016-66550038 TGAGATAATCAGAGAAATGTAGG - Intergenic
1195718510 X:107842289-107842311 CTGGATCATCAGTGTAAGGTAGG - Intronic
1195734033 X:107994952-107994974 CAGGACAATGAGATGAATGTTGG - Intergenic
1197503412 X:127270616-127270638 CAGGATAGTTAGAGCAATATTGG - Intergenic
1198535112 X:137577729-137577751 CAGGTTAATCAAAGTTATTTAGG - Intergenic
1199755639 X:150862400-150862422 CAGTGTCATCAGAGTAATGTGGG + Intronic
1200584719 Y:4994385-4994407 CAGAAAAATAAGAGTAAAGTAGG + Intergenic
1202024015 Y:20501388-20501410 CAGCATAATCACAGTGATGGTGG - Intergenic