ID: 1087880729

View in Genome Browser
Species Human (GRCh38)
Location 11:103413011-103413033
Sequence GATTCAGTAGTCTGGAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087880729_1087880735 27 Left 1087880729 11:103413011-103413033 CCTACCCTCCAGACTACTGAATC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1087880735 11:103413061-103413083 TTTGTTTTATCAAGCTCTTGAGG 0: 1
1: 0
2: 2
3: 40
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087880729 Original CRISPR GATTCAGTAGTCTGGAGGGT AGG (reversed) Intronic
902939932 1:19793708-19793730 GCTTCAGCAGTCTGGAGGAGGGG + Intronic
903469142 1:23573180-23573202 GATTCAGTAGATTCCAGGGTGGG - Intergenic
907054390 1:51351466-51351488 GATTCAGTAGGTTGTAGAGTTGG - Intergenic
909103236 1:71377365-71377387 GTTTCAATAGCCTGGAGGGAGGG + Intergenic
909161494 1:72156878-72156900 GAATGAGTAATCTGGAAGGTAGG - Intronic
912897196 1:113604812-113604834 GATTCAGAAGGGAGGAGGGTCGG + Intronic
917043485 1:170831824-170831846 GTTTCAGAAGTGGGGAGGGTGGG - Intergenic
917075173 1:171197555-171197577 GAATCAGAAATATGGAGGGTGGG - Intronic
920130799 1:203730407-203730429 GAGTCAGCAGCCTGGAGTGTGGG - Intronic
920260923 1:204687130-204687152 GAATGGGTTGTCTGGAGGGTAGG + Intergenic
920377471 1:205516925-205516947 GATGCTGTAGACTGGAGGGCGGG - Intronic
922506483 1:226128945-226128967 GATTCAGCAGGTTGGAGGGGGGG + Intergenic
924498802 1:244616474-244616496 GGTTCATGATTCTGGAGGGTGGG + Intronic
1063786624 10:9392323-9392345 GATTCAGGAGTTGGGAAGGTGGG - Intergenic
1064235572 10:13571084-13571106 GATTCAGAAGGAAGGAGGGTGGG + Intergenic
1067686960 10:48471454-48471476 GATTCAGAAGTCTGGGGGCTGGG - Intronic
1069295259 10:66835878-66835900 GATTTAGTAGGCTAGCGGGTGGG + Intronic
1070246749 10:74739371-74739393 TAGTCAGAAGTCTGGTGGGTGGG - Intergenic
1070386048 10:75925539-75925561 GGTTTAGTAGTTTGGAGGGGGGG + Intronic
1071453689 10:85824700-85824722 GACTCAGAAGACTGGAAGGTTGG - Intronic
1071819119 10:89262671-89262693 GATTTAGTAGTTTGGAGGTGAGG - Intronic
1072665319 10:97388483-97388505 GATTGAGAAGTCTGGAGGTGGGG - Exonic
1073101378 10:101008498-101008520 GAATCAGGAGTCTGGAGGGCTGG + Intronic
1073256016 10:102151866-102151888 GAGGCAGGAGTCTGGAGGCTGGG + Intergenic
1075882944 10:125870129-125870151 GAATCAGGAGTTAGGAGGGTAGG + Intronic
1083252778 11:61478935-61478957 GAATCGTTAGTCCGGAGGGTGGG + Intronic
1087880729 11:103413011-103413033 GATTCAGTAGTCTGGAGGGTAGG - Intronic
1089173721 11:116533767-116533789 GAGGCAGGAGGCTGGAGGGTGGG - Intergenic
1092230251 12:6772275-6772297 GAGGGAGCAGTCTGGAGGGTGGG + Intergenic
1092296492 12:7203238-7203260 GATTTAGTAGTCTGGGGTGATGG - Intronic
1092850993 12:12626435-12626457 GAATGAGTATTCTGGAGGGGAGG - Intronic
1093304860 12:17502733-17502755 GATTCAGCAGCGTGGAGGGGAGG + Intergenic
1096109337 12:49019935-49019957 GAATCAGATGTCTGGAGTGTAGG - Exonic
1096529186 12:52232810-52232832 GCTTCAGCAGCCTGGAGGATGGG + Intronic
1096635671 12:52957496-52957518 GATTCAGGTGTTTGGAGGGCAGG + Intergenic
1100441505 12:94621538-94621560 GATTCACTGGTCTGGGGAGTGGG - Intronic
1101849485 12:108390834-108390856 GATTGGTTAGGCTGGAGGGTGGG + Intergenic
1105259283 13:18766930-18766952 GATTCGGTGGTGAGGAGGGTTGG - Intergenic
1106078529 13:26481737-26481759 GATCAAGGAGTCTGCAGGGTTGG + Intergenic
1108096688 13:46909113-46909135 GACTCAGAAGTGAGGAGGGTGGG - Intergenic
1109858525 13:68166443-68166465 GATTCAGTAGTTTGGAGGTGGGG + Intergenic
1110720539 13:78756121-78756143 GATTGAATAGTATGGAGGGCTGG + Intergenic
1112135662 13:96575202-96575224 TATTCAGTAATCAGGAGGCTCGG - Intronic
1112245174 13:97726880-97726902 GATTCAGTAGGGTCGAGGGTGGG - Intergenic
1113745439 13:112741369-112741391 GAAGCTGTAGTCGGGAGGGTTGG + Intronic
1115789772 14:36865765-36865787 GATTCAGAAGTCTGGGGTTTGGG + Intronic
1125552974 15:40561539-40561561 GATTCAGAAGTGGGGAGGTTTGG + Intronic
1126552030 15:49942031-49942053 GATTCAGAAGTGAGGAGGGTGGG + Intronic
1128581721 15:68815229-68815251 GGTTCAGTAGATTGGAGGGTGGG - Intronic
1129394991 15:75239016-75239038 GAATCATTAGTCAGAAGGGTGGG + Intergenic
1131453665 15:92566495-92566517 CATTCAGTAGTCTGGGGTGGGGG - Intergenic
1133613018 16:7450815-7450837 GATTCAGGGGTCTGGTGGGGTGG + Intronic
1134220590 16:12350808-12350830 GATTCAGTAGACTGAGGGGAAGG - Intronic
1135472981 16:22748369-22748391 GATCCACTAGTGTGGAGGTTAGG + Intergenic
1143309979 17:5979870-5979892 GTTTCAGTAGCCTGGAGGAAGGG + Intronic
1143633951 17:8153856-8153878 GATTCAGGAGCCTGGAGGCCGGG + Intronic
1143884214 17:10053935-10053957 GATCCAGAAGCTTGGAGGGTGGG - Intronic
1144010032 17:11138652-11138674 GATTCAGAATTCTGCATGGTGGG + Intergenic
1145276213 17:21432652-21432674 GATTCACTGGGCTGGATGGTGGG + Intergenic
1145314053 17:21718566-21718588 GATTCACTGGGCTGGATGGTGGG + Intergenic
1146592013 17:34135412-34135434 GAACCAGCAGTCTGGAGAGTTGG - Intronic
1147600509 17:41742324-41742346 GATTCCTTAGTCTGGAGGGCAGG + Intergenic
1147842132 17:43379168-43379190 GGCTCAGTAGTCTGGAATGTGGG + Intergenic
1148798641 17:50209769-50209791 GCTGCAGCAGTCTGGAAGGTAGG - Intergenic
1148995022 17:51701995-51702017 GATTCTGTAGTCTGGTTGGCAGG - Intronic
1149289499 17:55202874-55202896 CTTTAAGTAGTCTGGAGGATGGG + Intergenic
1150461745 17:65359421-65359443 GATTCACTGTTCTGGATGGTTGG + Intergenic
1151352049 17:73537553-73537575 GGTTCTGCAGCCTGGAGGGTGGG + Intronic
1151557812 17:74855364-74855386 GCATCAGTAGACTGGAGGGCTGG - Intronic
1152813582 17:82393927-82393949 CCTTCAGTAGTGTGGATGGTGGG - Intronic
1153350838 18:4079526-4079548 GACTCAGAAGTGGGGAGGGTGGG + Intronic
1158294315 18:55977941-55977963 GATTCAGAAGGGAGGAGGGTGGG + Intergenic
1159654213 18:71012251-71012273 GATTCAGGAGTCTGCAGTGGCGG - Intergenic
1161982200 19:7635915-7635937 GCTTAAGAAGGCTGGAGGGTGGG - Intronic
1165008240 19:32823824-32823846 GATCCAGTAGACTGCAGAGTGGG + Intronic
1167739082 19:51312911-51312933 GAGGCAGGAGGCTGGAGGGTGGG + Intronic
1168254805 19:55159508-55159530 GAGTCAGTGGGGTGGAGGGTGGG - Intronic
1168275410 19:55275165-55275187 CATTTAGTAGTCTGGAGCCTGGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925914251 2:8593422-8593444 GATTAAGGTGTCTGCAGGGTTGG - Intergenic
926699759 2:15795966-15795988 GTTTCAGGAGTCTGGGGGCTTGG - Intergenic
931528084 2:63180340-63180362 GATTCAGTAGTGTAGGAGGTGGG - Intronic
932875065 2:75442798-75442820 GATTCAGAAGTGGGAAGGGTGGG + Intergenic
932895097 2:75631765-75631787 GATGCAGTAGTCTGTAGGTAGGG - Intergenic
933451521 2:82458988-82459010 GATTCAGGAATCTGGTGAGTGGG - Intergenic
935476808 2:103532326-103532348 GATTCAGAAGTGGGGAGGGTGGG - Intergenic
937811877 2:126208370-126208392 TTTTCAGTAGTCAAGAGGGTAGG - Intergenic
941531969 2:166681583-166681605 GATTCAGTAGGTTGGAGGCAGGG - Intergenic
943960450 2:194256255-194256277 GATCCAGGAGTCCGGAGCGTAGG + Intergenic
945068962 2:205972282-205972304 GATTCTGTAGTCTAGACAGTTGG + Intergenic
945969128 2:216219174-216219196 CATTCAGTAGTACTGAGGGTTGG + Intergenic
946770500 2:223084145-223084167 CATTCAGTACCCTGGAGTGTGGG + Intronic
1170306822 20:14947640-14947662 GAGTCAGAACTCTGCAGGGTGGG - Intronic
1170393745 20:15903567-15903589 GATTCAGTAGGTTTGGGGGTGGG + Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1173066287 20:39715587-39715609 AATTCAGTAGTCTAGAGTCTTGG - Intergenic
1174785885 20:53432123-53432145 GACTCAGAAGTGGGGAGGGTTGG - Intronic
1175655750 20:60768876-60768898 AATTCAGTAGGTTGGAGGTTAGG + Intergenic
1175780226 20:61677401-61677423 GAGGCAGGAGTCTGGAGGGAAGG - Intronic
1179318353 21:40267017-40267039 GACTCAGAAGTGGGGAGGGTGGG + Intronic
1182761800 22:32728453-32728475 GATGCAGAGGTCTGGAGGGGAGG - Intronic
1184338914 22:43874749-43874771 CATTCTGCAGTCTGGAGGATGGG - Intergenic
950616971 3:14167557-14167579 GAGTCAGTAGTCGGAAGAGTTGG - Intronic
958801579 3:98762541-98762563 GAATCAGTAGTCTGGTTGATGGG - Intronic
960190192 3:114694982-114695004 GCATCAGCAGTCTGCAGGGTTGG + Intronic
960379892 3:116947165-116947187 GATTCAGTAGTTTGGGGGCAAGG - Intronic
961871814 3:129993886-129993908 GATTCAGTAGTTCTGGGGGTGGG - Intergenic
962381006 3:134898070-134898092 GATTCCGGAGTCTGTGGGGTGGG + Intronic
963331253 3:143918949-143918971 GTTTCAGAAGTATGGTGGGTAGG + Intergenic
967790723 3:193546205-193546227 TATTCAGGAGTCCTGAGGGTGGG - Intronic
971104296 4:23505732-23505754 GACTCAAAAGTCAGGAGGGTAGG - Intergenic
976803945 4:89024870-89024892 GATTCAGTAGTATGAGGTGTGGG + Intronic
978342295 4:107731275-107731297 GAGTCAGTAGGCTGGGGGGAAGG - Intergenic
980766117 4:137307115-137307137 AATTCAGTAGTTTTGAGGGGTGG - Intergenic
981600307 4:146481122-146481144 GCTTCTGTATTCTCGAGGGTGGG - Intronic
983478292 4:168242311-168242333 CATTCTGGGGTCTGGAGGGTGGG - Intronic
986195232 5:5532211-5532233 GATACAGTAGTCTGGAGTTCAGG - Intergenic
986327227 5:6685225-6685247 GATACATTAGCCTGGAGGGAGGG + Intergenic
986328172 5:6696092-6696114 GACTCAGAAGTGGGGAGGGTGGG - Intergenic
987121986 5:14776343-14776365 GAGTCTGGAGTCTGGAGGGTCGG + Intronic
988979032 5:36545910-36545932 GACTCAGAAGTAAGGAGGGTGGG + Intergenic
989407746 5:41080298-41080320 GACTCAGAAGTGGGGAGGGTTGG - Intergenic
991016759 5:61941214-61941236 GGTTCAGTAGCCAAGAGGGTGGG - Intergenic
991289565 5:65019682-65019704 GATTCAGTAGTCTGAAAGAGAGG - Intergenic
992172655 5:74119735-74119757 GATAGAGGATTCTGGAGGGTTGG - Intergenic
994493236 5:100475272-100475294 GATTATGTACTCTGGAGAGTAGG - Intergenic
997032548 5:130148003-130148025 CCTTCAGGAGTATGGAGGGTGGG - Intronic
1012755787 6:103228320-103228342 CATTCTGGAGTCTGGAGGGATGG - Intergenic
1012979982 6:105819108-105819130 GATTCAGTAGTTTGGGGGTAGGG - Intergenic
1013372108 6:109480065-109480087 GATTTAGTTGTCTGGAGCCTTGG - Intronic
1013496159 6:110699568-110699590 GATTCAGAAGAAGGGAGGGTGGG + Intronic
1014636588 6:123854747-123854769 AGCTCTGTAGTCTGGAGGGTGGG + Intronic
1016144686 6:140655401-140655423 GTTTCAGAATTCTGGAGGGTAGG + Intergenic
1016349214 6:143148932-143148954 TATTCAGTAGTCTGTAGCTTAGG + Intronic
1016869894 6:148806699-148806721 GACTCACTGGTCTGGAGGCTGGG + Intronic
1017580913 6:155864426-155864448 GGTTCTGTAGTCTGGCTGGTGGG + Intergenic
1018704751 6:166455573-166455595 GCTTCGCTAGTCTGGAGCGTTGG - Intronic
1018706884 6:166469968-166469990 AATGCAGCAGTGTGGAGGGTGGG + Intronic
1021308395 7:19060615-19060637 GATTCAAAAGTCAGGAAGGTAGG - Intronic
1022281327 7:28913064-28913086 GACTCAGAAGTGGGGAGGGTGGG + Intergenic
1022298850 7:29083492-29083514 GATTCAGGAATCTGGAGGGCTGG + Intronic
1022369049 7:29753147-29753169 GATTCAATTTTCTGGAGGATGGG + Intergenic
1023154427 7:37233901-37233923 GATTCAGTAGGCTATAAGGTGGG + Intronic
1024582923 7:50814792-50814814 GATTCAGTAGATTTGAGGGAGGG + Intergenic
1028174392 7:87636876-87636898 GATTCATTGGTCTGCAGGGCTGG + Intronic
1030698149 7:112608511-112608533 GTTTCACTATTCTGGAGGCTGGG - Intergenic
1031526197 7:122823542-122823564 AATTCAGTAGGCTTGGGGGTGGG + Intronic
1032176578 7:129633691-129633713 GACTGAGAAGTCAGGAGGGTTGG - Intronic
1036983096 8:13493338-13493360 GCTACATTAGTCTGGAGGCTTGG + Intronic
1044263676 8:90157770-90157792 GATTCATTAGTCTTGAGGTGGGG - Intergenic
1046777954 8:118183827-118183849 GATTCAGAAGGCGGGAGGGTGGG - Intergenic
1047063972 8:121260079-121260101 GATGCAGATCTCTGGAGGGTTGG - Intergenic
1049040252 8:140107427-140107449 GTTGCAGTTGTCTTGAGGGTGGG - Intronic
1050764599 9:9116457-9116479 GAGTCAGAAGTGGGGAGGGTAGG + Intronic
1050805167 9:9667792-9667814 TATTCAGAGGTCTGTAGGGTAGG + Intronic
1051546345 9:18280097-18280119 GAGCCAGTAGTCTGGAGCCTGGG + Intergenic
1051948462 9:22601285-22601307 GATTCAGAAGTCAAGAGTGTGGG - Intergenic
1053237509 9:36469145-36469167 GATCCAGGATTATGGAGGGTGGG - Intronic
1053944082 9:43287335-43287357 GATTGAGGAGTCAGGAGGGATGG + Intergenic
1059564192 9:115366486-115366508 GATTCAGCAGCCTGGAGACTGGG - Intronic
1203587217 Un_KI270747v1:15913-15935 GATTGAGGAGTCAGGAGGGATGG + Intergenic
1186122541 X:6379584-6379606 GACTCAGAAGTTGGGAGGGTGGG - Intergenic
1190914846 X:54803663-54803685 GCTTCAGGAGTCTGGAGTCTTGG + Intergenic
1192689721 X:73349555-73349577 AATTCAGGAGTCTGGAGGATGGG - Intergenic
1192791595 X:74387379-74387401 GATTATCTAGTCTGGAGAGTAGG + Intergenic
1194718808 X:97316666-97316688 AAATCAGTAGACTAGAGGGTAGG + Intronic
1195154926 X:102113501-102113523 GATTCAGAGGCCTGGATGGTCGG + Intergenic
1195489878 X:105454911-105454933 GCTTCAGTAGTCTGGGCTGTGGG - Intronic
1197981991 X:132226960-132226982 GAATGAGAAGTTTGGAGGGTTGG + Intergenic
1199587535 X:149431932-149431954 GACACAGTAGTCTGGAGCCTGGG + Intergenic
1200794312 Y:7326501-7326523 GACTCAGAAGTGGGGAGGGTGGG + Intergenic