ID: 1087885165

View in Genome Browser
Species Human (GRCh38)
Location 11:103472111-103472133
Sequence TAGTTCATATGGAAGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087885165 Original CRISPR TAGTTCATATGGAAGAATGG TGG Intronic
900627383 1:3615099-3615121 AAATTCATTTGGAAGAATGACGG - Intergenic
908391037 1:63683814-63683836 TAGTTCCTCTGTAAGACTGGAGG - Intergenic
910934020 1:92472009-92472031 AAGTAAATATGGCAGAATGGTGG + Intergenic
912184987 1:107264475-107264497 AACTTCATAGGGAAGGATGGGGG - Intronic
913679071 1:121171534-121171556 CAGTGCAAATGGAAGAATGTGGG + Intronic
914030904 1:143959178-143959200 CAGTGCAAATGGAAGAATGCGGG + Intronic
914158546 1:145108782-145108804 CAGTGCAAATGGAAGAATGCGGG - Intronic
920466371 1:206190072-206190094 CAGTGCAAATGGAAGAATGCGGG + Intronic
921745293 1:218733465-218733487 TATTTCATATGGCAAAATGGGGG + Intergenic
922324910 1:224518854-224518876 TGCTTCATATGGAGGAATAGTGG + Intronic
924377355 1:243426793-243426815 GATTTAACATGGAAGAATGGAGG + Intronic
1064554409 10:16534309-16534331 CAGTTCTTATGGTACAATGGAGG + Intergenic
1071168414 10:82833916-82833938 CACTTCACATGGGAGAATGGAGG + Intronic
1071728157 10:88220181-88220203 TAGTTCATATGAATGAGTTGTGG + Intergenic
1071746208 10:88422288-88422310 CATTTTATATGGAAGGATGGGGG + Intronic
1074072314 10:110085075-110085097 TAATTCATATCAAAAAATGGGGG - Intronic
1074277577 10:112018842-112018864 TATTTTAAAGGGAAGAATGGGGG - Intergenic
1074538435 10:114345465-114345487 TAGTGCATATGGAATGATGAGGG + Intronic
1078195932 11:9137240-9137262 AAGTTAAGATGGAAGAAGGGAGG + Intronic
1079137912 11:17786705-17786727 TTGTTCATGTGGGAAAATGGAGG - Intergenic
1080564733 11:33497596-33497618 TAGTATATCTGGAAGGATGGAGG + Intergenic
1086543891 11:87945696-87945718 TATTTCAGATGAAATAATGGTGG + Intergenic
1087238846 11:95752610-95752632 TAGTGGATGAGGAAGAATGGAGG + Intergenic
1087441014 11:98184166-98184188 TAATTCATATCGAGGACTGGGGG - Intergenic
1087611912 11:100445135-100445157 TAGATAATATGGAAAAATGTTGG + Intergenic
1087885165 11:103472111-103472133 TAGTTCATATGGAAGAATGGTGG + Intronic
1088075739 11:105846316-105846338 TAGTTAATTTGGAAGAAGTGAGG + Intronic
1088108119 11:106228491-106228513 TAGTTCCTTTGGTAAAATGGAGG - Intergenic
1091176177 11:133560028-133560050 TAGTTCATATGGAATCATAATGG + Intergenic
1093088818 12:14897500-14897522 AAGTTCTTATGGGAAAATGGAGG + Intronic
1096025336 12:48356061-48356083 TAGGACAGAGGGAAGAATGGAGG + Intergenic
1097982421 12:65748017-65748039 GAGTGAATTTGGAAGAATGGAGG + Intergenic
1099545746 12:83977689-83977711 TAATGCATATGGATGAAGGGTGG - Intergenic
1099685650 12:85885141-85885163 TAGTTCAGAGGGAAATATGGTGG - Intergenic
1101675661 12:106914170-106914192 TCTTACACATGGAAGAATGGAGG + Intergenic
1102830140 12:115990661-115990683 AACTTGATCTGGAAGAATGGTGG + Intronic
1105766793 13:23567778-23567800 TTGTTCATATCCAAGAAGGGAGG - Intergenic
1107752124 13:43579199-43579221 TAGTAAATGAGGAAGAATGGTGG + Intronic
1108557418 13:51608306-51608328 TAGTTCATGAGGAAAAATAGGGG - Intronic
1109959990 13:69617196-69617218 TAGGTCATTTGTTAGAATGGAGG - Intergenic
1110898313 13:80785671-80785693 TATTTCATATGTAAAAGTGGTGG - Intergenic
1111283770 13:86062694-86062716 TAGTTCAAAGGGAAGCATAGTGG + Intergenic
1112653869 13:101428041-101428063 TAGTTCATGTGGCAGCAAGGAGG - Intergenic
1114222011 14:20705063-20705085 TAGTTCCTTTGCAAGAATGAGGG - Intergenic
1117120881 14:52567378-52567400 AAGTTTATATGTAAGAAAGGTGG - Intronic
1119071062 14:71584602-71584624 CATTTCTTCTGGAAGAATGGTGG + Intronic
1123416270 15:20097780-20097802 TGGTTCAGATGGGAGAATTGAGG + Intergenic
1123525609 15:21104885-21104907 TGGTTCAGATGGGAGAATTGAGG + Intergenic
1123911783 15:24975202-24975224 TACTAAATATGGAAGAATGTTGG + Intronic
1129609904 15:77044828-77044850 TGGTTCATATTGAAAACTGGGGG + Exonic
1129611761 15:77065784-77065806 TATTTCATATGAATGAATGATGG + Intronic
1130401428 15:83558358-83558380 TAGTGCACAAGGAAGAATGGAGG - Intronic
1130984492 15:88836185-88836207 TAGTTCACCTGGAAGAGGGGAGG - Exonic
1132069609 15:98764473-98764495 AATTACATATGGAAGAATGCTGG + Intronic
1132483600 16:178491-178513 TATTTCATCAGGAAGAATGGAGG + Intergenic
1138800857 16:60027047-60027069 GTGTTCATTTGGAAGAATGCTGG + Intergenic
1151270775 17:72994010-72994032 TAGTTCATATGGAAAAATACAGG - Intronic
1151571848 17:74930410-74930432 TATGTCATGTGGAAGAATGTGGG + Exonic
1152590804 17:81211056-81211078 TACTTTCTCTGGAAGAATGGTGG - Intronic
1152964472 18:101778-101800 TAGTGGATATGGTAGAATGAAGG + Intergenic
1153117474 18:1677160-1677182 TAGTTCTCATGGTAAAATGGTGG - Intergenic
1154328483 18:13409721-13409743 TAGTACATGTAGAAGAATTGAGG + Intronic
1155824541 18:30422814-30422836 TACTCCATATGGAAGAAAAGAGG + Intergenic
1156424216 18:36991625-36991647 TAGCTCAAATTCAAGAATGGTGG - Intronic
1157320897 18:46633041-46633063 TTGTTCATTTGGAAGAAAAGAGG - Intronic
1159299624 18:66546163-66546185 TAGTTCCTTTAGAAGCATGGAGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164700316 19:30280159-30280181 AAGTGCAGATGGAAGGATGGAGG - Intronic
1168687930 19:58359396-58359418 GAGTAAAAATGGAAGAATGGGGG + Intronic
926181972 2:10652665-10652687 TGGTTCATTTGGGAGAATGAGGG - Intronic
926642550 2:15253014-15253036 GAGTTCATGTGGAAGAAGGAGGG + Intronic
928799947 2:35076889-35076911 TACTTCATCTGTAAGAATTGGGG - Intergenic
930569500 2:53067060-53067082 TAGGTAATACGGAAGAATGCTGG - Intergenic
931038723 2:58273148-58273170 TGGCTCATACGGAACAATGGAGG + Intergenic
931553734 2:63476303-63476325 TGGTTCATGTTGAAGAATGAAGG - Intronic
931965810 2:67533233-67533255 TAGTTAATAAGATAGAATGGTGG + Intergenic
935837482 2:107070958-107070980 GCTTTCATATGGAAGAATGAGGG - Intergenic
936571598 2:113621440-113621462 TAGTGGATATGGTAGAATGAAGG + Intergenic
940917810 2:159276393-159276415 TAGTTCACATGGAATAATAATGG + Intronic
942567381 2:177280519-177280541 TAGTTCTTATGGAGGAACTGTGG - Intronic
942773696 2:179554388-179554410 GGGTATATATGGAAGAATGGTGG + Intronic
943234119 2:185295588-185295610 AAGTTCATATGGAAGAAAAAAGG + Intergenic
945606930 2:211945191-211945213 CAGTTCACATGGAAGAATATGGG - Intronic
945719051 2:213395759-213395781 TAGTTACCAGGGAAGAATGGGGG + Intronic
945928757 2:215833060-215833082 TAGTTCAAATGGAGAAGTGGTGG + Intergenic
946270797 2:218591780-218591802 TACTTCATCTGGAAGAGAGGAGG + Intronic
946490500 2:220144795-220144817 TAATTCAAATGAAATAATGGAGG + Intergenic
947785556 2:232815350-232815372 TTGTTCATCTGTAAAAATGGGGG + Intronic
948149634 2:235734805-235734827 AAGTTCACATGGAAGAGAGGAGG + Intronic
1169853879 20:10082565-10082587 AAGTTTCTATGAAAGAATGGAGG + Intergenic
1169935909 20:10883017-10883039 TACTTCATACGGAAAAATGCTGG + Intergenic
1170023437 20:11862682-11862704 TAGTGAATATGCAAGGATGGAGG - Intergenic
1170684164 20:18553984-18554006 TAGTTGATATAGAAGAGAGGAGG + Intronic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1176877399 21:14146472-14146494 TAGTTGAAATGGAAAAATGAGGG - Intronic
1178428236 21:32496620-32496642 TAGCTCCTCTGGTAGAATGGAGG + Intronic
1180742064 22:18060644-18060666 TACTTCACATGTAAGAAAGGTGG - Intergenic
1182543415 22:31058227-31058249 TGGTTCAGATGGGAGAATTGAGG - Intergenic
1183557294 22:38539914-38539936 TATTTCATATTGAGGAATGAGGG - Intronic
950688616 3:14637388-14637410 TAGTTCATGTGGATGAAGGTTGG - Intergenic
952001250 3:28788012-28788034 TATTTCTTATTGAATAATGGAGG + Intergenic
952599364 3:35060779-35060801 TAGTTCATATGAAATATTGTAGG - Intergenic
953017754 3:39094684-39094706 CACTTCATATGGAAGAGCGGTGG + Exonic
957650707 3:82999068-82999090 TAACTCATGTAGAAGAATGGAGG + Intergenic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
958667228 3:97156987-97157009 TACTTCTTAAGCAAGAATGGTGG - Intronic
960132655 3:114073762-114073784 TATCTAAAATGGAAGAATGGGGG - Intronic
960151451 3:114252778-114252800 TACTTGCTATGCAAGAATGGAGG + Intergenic
960612151 3:119564657-119564679 AAGTTCATATGGAACAAAGAAGG - Intergenic
961516649 3:127442127-127442149 TCTTTCATATAAAAGAATGGAGG + Intergenic
962337871 3:134553253-134553275 TATTTCAACTGGAAAAATGGGGG + Intronic
962596428 3:136950237-136950259 TTTTTCATAAGGAAGACTGGGGG - Intronic
964439093 3:156686602-156686624 TAGTTCATCTGGACTAATTGGGG + Intronic
964708847 3:159649701-159649723 TACATCATATGGAAGATTGATGG + Intronic
966557794 3:181283384-181283406 TAGTTGCTATGGAGGAATGGTGG + Intergenic
966815120 3:183884373-183884395 TAGTACAGCTGGCAGAATGGCGG - Intronic
970533409 4:17004926-17004948 TCCTTCATATGGATGGATGGTGG + Intergenic
973846162 4:54915228-54915250 GAGTTCATATGGAAGAATGGTGG + Intergenic
974521767 4:62989978-62990000 TAATACATATGGAAGAATTAAGG + Intergenic
976667615 4:87613768-87613790 TATTCCCTATGGAAGGATGGAGG - Exonic
978634495 4:110788188-110788210 TGGTTCAAAAGGATGAATGGTGG - Intergenic
980140241 4:128906914-128906936 TAAAACATATGGAAGAATCGGGG + Intronic
980551657 4:134343944-134343966 TAGTTAATATGGAAAAATCCTGG - Intergenic
980988266 4:139716422-139716444 TAGTTCATCTGGAGGTAGGGAGG - Intronic
981947809 4:150369869-150369891 AAGTTCAAATGTAATAATGGAGG - Intronic
982761752 4:159292582-159292604 TATTTCATTAGGAAGAAGGGTGG - Intronic
984491154 4:180436785-180436807 CAGTTCACATGAAAGAATTGTGG + Intergenic
984823253 4:183902976-183902998 TTGTTCATATGAAAGACGGGAGG - Intronic
986981718 5:13455826-13455848 TAGCTGATATGGAAGACAGGTGG + Intergenic
987013223 5:13789521-13789543 TATTTGATATGAAAGACTGGTGG + Intronic
987634166 5:20518251-20518273 TAGTTATTATGGAAGAAGGAAGG - Intronic
988983331 5:36593482-36593504 TCCTTCATATGGCAGCATGGAGG + Intergenic
989491909 5:42066488-42066510 TTGTTTATATCAAAGAATGGGGG - Intergenic
989650726 5:43686861-43686883 TGGTACACATGAAAGAATGGAGG + Intronic
990513524 5:56511056-56511078 AAGTTCATATAGAAGAATAATGG - Intergenic
990905968 5:60803296-60803318 TAGCTCACATGGAAGAAGGAAGG + Intronic
991270788 5:64777860-64777882 TAGTAGATATGGAAGATTTGTGG + Intronic
992618057 5:78564376-78564398 TAGCTCATATGGAAGGCTTGTGG - Intronic
996118023 5:119640042-119640064 TAGATCATGTGGAAGATTTGGGG - Intergenic
996701886 5:126458126-126458148 TATTTCATATTTAAGAATGAGGG + Intronic
1001462327 5:171927317-171927339 TAGTTCCTTTGAAAGAATTGAGG - Intronic
1002786550 6:404780-404802 TAGTTCCTCTTGAAGAATCGAGG + Intronic
1003777460 6:9384929-9384951 TAGTTAATGGGGAAAAATGGAGG + Intergenic
1006308903 6:33243302-33243324 TGGTTCAGATGGAAGCATGCAGG - Intergenic
1007407474 6:41643337-41643359 TGGGGCATCTGGAAGAATGGTGG - Intronic
1008454479 6:51693287-51693309 TGGTTCACATGGAGGCATGGAGG - Intronic
1011927524 6:92665687-92665709 TAGTTCTAATGGAAGCATGCTGG + Intergenic
1013450324 6:110274378-110274400 TACTTCATTTAGAATAATGGTGG - Intronic
1013840188 6:114382428-114382450 TTGTACCTATGGTAGAATGGAGG + Intergenic
1014835705 6:126158028-126158050 TATTACATATGGCAGAAGGGAGG - Intergenic
1016407510 6:143745939-143745961 TAGTTTACAAGGAAGAAAGGGGG + Intronic
1016555326 6:145329862-145329884 AGGTTCATATTGAAGAATGATGG + Intergenic
1016718904 6:147269777-147269799 TACTTGATGTGAAAGAATGGAGG + Intronic
1018045687 6:159964271-159964293 GAGTGAATCTGGAAGAATGGGGG - Intergenic
1018725322 6:166608063-166608085 TAGTGCATCTTGAAGAATGGAGG + Intronic
1021950828 7:25773231-25773253 GAGAGCATATGGGAGAATGGAGG - Intergenic
1023375963 7:39555237-39555259 TAGTTCTTAAAGAAGAAGGGAGG - Intergenic
1025114741 7:56248021-56248043 TAGTTACTATGGGAGAAAGGAGG + Intergenic
1028451752 7:90993032-90993054 TAGTTCAGAAGGGAGAAGGGAGG + Intronic
1028884597 7:95917361-95917383 TAGTTCATCTCAAAGAATGGAGG - Intronic
1029949258 7:104565807-104565829 TAGGTCATATGGCAAAATTGTGG - Intronic
1030012918 7:105189224-105189246 TCGTTCATAGTGAAGAATGAGGG - Intronic
1030555788 7:111022110-111022132 TGGTTCACTTGGAAGAAGGGTGG - Intronic
1030568299 7:111188410-111188432 TTCTTCATATGGCAGAAAGGGGG + Intronic
1031599595 7:123690574-123690596 TAATTGATGTGTAAGAATGGGGG - Intronic
1032583963 7:133129606-133129628 TAGCTCTTATGGAGGCATGGTGG - Intergenic
1033404459 7:141058640-141058662 TAGTTCATATCAAAGAATTGTGG - Intergenic
1038773254 8:30503576-30503598 AAGCTCATTAGGAAGAATGGTGG + Intronic
1041840418 8:62264141-62264163 TAGTTCAGAAGGAAAAATGAGGG + Intronic
1043007362 8:74836352-74836374 TAGTTGATTTGGAGGAATGGGGG + Intronic
1043081994 8:75778162-75778184 AAGTTCAGATGGAAGACTGTGGG + Intergenic
1044186379 8:89256753-89256775 TAATTCACTTGGAATAATGGCGG - Intergenic
1044926230 8:97210853-97210875 TATTTCATATTTAAGAATGAGGG - Intergenic
1045711609 8:104991011-104991033 TAATTCATAGGGAACCATGGTGG + Intronic
1046601645 8:116324179-116324201 TAGGTGATCTAGAAGAATGGTGG + Intergenic
1047142120 8:122153075-122153097 CAGGGCACATGGAAGAATGGGGG - Intergenic
1047689017 8:127331557-127331579 TAGTTACCAGGGAAGAATGGAGG + Intergenic
1048613731 8:136051867-136051889 GAGTTTACATTGAAGAATGGAGG - Intergenic
1050625508 9:7499833-7499855 TAGTTCAAATGGGAGGATGCTGG + Intergenic
1052152391 9:25133116-25133138 TACTTCCTTTGGAAGATTGGAGG - Intergenic
1055419019 9:76116807-76116829 AAGGTGATATGGTAGAATGGTGG - Intronic
1055733025 9:79298516-79298538 AAGGGGATATGGAAGAATGGTGG + Intergenic
1058131712 9:101260911-101260933 TAGTTAAGAAAGAAGAATGGAGG + Intronic
1059218415 9:112589289-112589311 TTGTTCATATTTAAGAATGCAGG + Intronic
1059832485 9:118113520-118113542 AAGTTCATAAAGAAGAATGTAGG + Intergenic
1061388478 9:130304177-130304199 TAAATCAAATGGCAGAATGGAGG - Intronic
1061431601 9:130534772-130534794 AAGTGAAGATGGAAGAATGGAGG + Intergenic
1187996567 X:24933211-24933233 TAGTTCATAGGGAACAATGGGGG + Intronic
1188144438 X:26592626-26592648 TAGTTCAAATAAAAGAATGATGG + Intergenic
1189228210 X:39431372-39431394 TAATTCATGTGGAAAAATTGGGG + Intergenic
1189767848 X:44390362-44390384 TATTTCACATGAGAGAATGGAGG + Intergenic
1190792628 X:53714298-53714320 TAGATACTATGGAACAATGGTGG + Intergenic
1194363221 X:92980808-92980830 TATTAAATATTGAAGAATGGTGG - Intergenic
1197161913 X:123333311-123333333 TAATTCATATAGAAGAAGGAAGG + Intronic
1200671461 Y:6097057-6097079 TATTAAATATTGAAGAATGGTGG - Intergenic