ID: 1087893853

View in Genome Browser
Species Human (GRCh38)
Location 11:103565650-103565672
Sequence GATAATCATTTCCCTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087893849_1087893853 -9 Left 1087893849 11:103565636-103565658 CCCCCAAGAAATGAGATAATCAT No data
Right 1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG No data
1087893847_1087893853 27 Left 1087893847 11:103565600-103565622 CCATTAAGTGAAATTATTGGTAT No data
Right 1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG No data
1087893848_1087893853 1 Left 1087893848 11:103565626-103565648 CCAATTATGTCCCCCAAGAAATG No data
Right 1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG No data
1087893850_1087893853 -10 Left 1087893850 11:103565637-103565659 CCCCAAGAAATGAGATAATCATT No data
Right 1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087893853 Original CRISPR GATAATCATTTCCCTCTTAC TGG Intergenic
No off target data available for this crispr