ID: 1087894603

View in Genome Browser
Species Human (GRCh38)
Location 11:103573325-103573347
Sequence TGTTCTCTTAACCACTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087894603_1087894606 5 Left 1087894603 11:103573325-103573347 CCGCCACAGTGGTTAAGAGAACA No data
Right 1087894606 11:103573353-103573375 ATAAGCTGCTGACAGAGGCAAGG No data
1087894603_1087894605 0 Left 1087894603 11:103573325-103573347 CCGCCACAGTGGTTAAGAGAACA No data
Right 1087894605 11:103573348-103573370 GCAGCATAAGCTGCTGACAGAGG No data
1087894603_1087894607 21 Left 1087894603 11:103573325-103573347 CCGCCACAGTGGTTAAGAGAACA No data
Right 1087894607 11:103573369-103573391 GGCAAGGAAAGACCAGCCAAAGG No data
1087894603_1087894608 30 Left 1087894603 11:103573325-103573347 CCGCCACAGTGGTTAAGAGAACA No data
Right 1087894608 11:103573378-103573400 AGACCAGCCAAAGGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087894603 Original CRISPR TGTTCTCTTAACCACTGTGG CGG (reversed) Intergenic
No off target data available for this crispr