ID: 1087895363

View in Genome Browser
Species Human (GRCh38)
Location 11:103580161-103580183
Sequence GAAGCTAATCCAGAAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087895363_1087895371 28 Left 1087895363 11:103580161-103580183 CCCCTCTCTTCTGGATTAGCTTC No data
Right 1087895371 11:103580212-103580234 CCTTCAACATAGCCTCCAAAGGG No data
1087895363_1087895369 27 Left 1087895363 11:103580161-103580183 CCCCTCTCTTCTGGATTAGCTTC No data
Right 1087895369 11:103580211-103580233 ACCTTCAACATAGCCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087895363 Original CRISPR GAAGCTAATCCAGAAGAGAG GGG (reversed) Intergenic
No off target data available for this crispr