ID: 1087897023

View in Genome Browser
Species Human (GRCh38)
Location 11:103597520-103597542
Sequence CAGAGTAGACAGAAGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087897023_1087897027 27 Left 1087897023 11:103597520-103597542 CCTGTTTCCTTCTGTCTACTCTG No data
Right 1087897027 11:103597570-103597592 AACAGGTGACAGAAGGAAACAGG No data
1087897023_1087897026 20 Left 1087897023 11:103597520-103597542 CCTGTTTCCTTCTGTCTACTCTG No data
Right 1087897026 11:103597563-103597585 GAAGTAAAACAGGTGACAGAAGG No data
1087897023_1087897025 10 Left 1087897023 11:103597520-103597542 CCTGTTTCCTTCTGTCTACTCTG No data
Right 1087897025 11:103597553-103597575 TATATTTAAAGAAGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087897023 Original CRISPR CAGAGTAGACAGAAGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr