ID: 1087899313

View in Genome Browser
Species Human (GRCh38)
Location 11:103622813-103622835
Sequence CTGCTTAGATAGATCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087899313_1087899315 4 Left 1087899313 11:103622813-103622835 CCTTGAAAGATCTATCTAAGCAG No data
Right 1087899315 11:103622840-103622862 ACTGCATTTTCTTTTTTTCGTGG No data
1087899313_1087899317 16 Left 1087899313 11:103622813-103622835 CCTTGAAAGATCTATCTAAGCAG No data
Right 1087899317 11:103622852-103622874 TTTTTTCGTGGTGTCTTGGAAGG No data
1087899313_1087899318 23 Left 1087899313 11:103622813-103622835 CCTTGAAAGATCTATCTAAGCAG No data
Right 1087899318 11:103622859-103622881 GTGGTGTCTTGGAAGGTAGAAGG No data
1087899313_1087899316 12 Left 1087899313 11:103622813-103622835 CCTTGAAAGATCTATCTAAGCAG No data
Right 1087899316 11:103622848-103622870 TTCTTTTTTTCGTGGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087899313 Original CRISPR CTGCTTAGATAGATCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr