ID: 1087901304

View in Genome Browser
Species Human (GRCh38)
Location 11:103644892-103644914
Sequence CGGCGTTCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087901295_1087901304 23 Left 1087901295 11:103644846-103644868 CCTGCCGGATCTGGAGGGGTGGA 0: 8
1: 57
2: 126
3: 136
4: 227
Right 1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG No data
1087901293_1087901304 24 Left 1087901293 11:103644845-103644867 CCCTGCCGGATCTGGAGGGGTGG 0: 8
1: 65
2: 125
3: 157
4: 259
Right 1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG No data
1087901296_1087901304 19 Left 1087901296 11:103644850-103644872 CCGGATCTGGAGGGGTGGAAGTC 0: 21
1: 71
2: 95
3: 106
4: 191
Right 1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087901304 Original CRISPR CGGCGTTCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr