ID: 1087910953

View in Genome Browser
Species Human (GRCh38)
Location 11:103752836-103752858
Sequence CACTTACTGCAGAGGCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087910953_1087910958 23 Left 1087910953 11:103752836-103752858 CCATAGAGCCTCTGCAGTAAGTG No data
Right 1087910958 11:103752882-103752904 CAACTTAATGATACTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087910953 Original CRISPR CACTTACTGCAGAGGCTCTA TGG (reversed) Intergenic
No off target data available for this crispr