ID: 1087913961

View in Genome Browser
Species Human (GRCh38)
Location 11:103786474-103786496
Sequence TCTTACATGGGCATGGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087913957_1087913961 27 Left 1087913957 11:103786424-103786446 CCAGTTGGTGGAACAGTCAGCAC No data
Right 1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087913961 Original CRISPR TCTTACATGGGCATGGTTTA TGG Intergenic
No off target data available for this crispr