ID: 1087919499

View in Genome Browser
Species Human (GRCh38)
Location 11:103849985-103850007
Sequence CTTCATAAACAGAAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087919499_1087919502 28 Left 1087919499 11:103849985-103850007 CCTTGCTGCTTCTGTTTATGAAG No data
Right 1087919502 11:103850036-103850058 TGGACACAGTGATTACCTCAAGG No data
1087919499_1087919501 8 Left 1087919499 11:103849985-103850007 CCTTGCTGCTTCTGTTTATGAAG No data
Right 1087919501 11:103850016-103850038 CAGTTTTCTTGCTCTGACAATGG No data
1087919499_1087919503 29 Left 1087919499 11:103849985-103850007 CCTTGCTGCTTCTGTTTATGAAG No data
Right 1087919503 11:103850037-103850059 GGACACAGTGATTACCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087919499 Original CRISPR CTTCATAAACAGAAGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr