ID: 1087919499 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:103849985-103850007 |
| Sequence | CTTCATAAACAGAAGCAGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087919499_1087919502 | 28 | Left | 1087919499 | 11:103849985-103850007 | CCTTGCTGCTTCTGTTTATGAAG | No data | ||
| Right | 1087919502 | 11:103850036-103850058 | TGGACACAGTGATTACCTCAAGG | No data | ||||
| 1087919499_1087919501 | 8 | Left | 1087919499 | 11:103849985-103850007 | CCTTGCTGCTTCTGTTTATGAAG | No data | ||
| Right | 1087919501 | 11:103850016-103850038 | CAGTTTTCTTGCTCTGACAATGG | No data | ||||
| 1087919499_1087919503 | 29 | Left | 1087919499 | 11:103849985-103850007 | CCTTGCTGCTTCTGTTTATGAAG | No data | ||
| Right | 1087919503 | 11:103850037-103850059 | GGACACAGTGATTACCTCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087919499 | Original CRISPR | CTTCATAAACAGAAGCAGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||