ID: 1087923920

View in Genome Browser
Species Human (GRCh38)
Location 11:103897975-103897997
Sequence TAAATCCTAGGTTCTAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087923920_1087923924 11 Left 1087923920 11:103897975-103897997 CCAACCCTAGAACCTAGGATTTA No data
Right 1087923924 11:103898009-103898031 TGAAAGTCTGAAGAAAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087923920 Original CRISPR TAAATCCTAGGTTCTAGGGT TGG (reversed) Intergenic
No off target data available for this crispr