ID: 1087926916

View in Genome Browser
Species Human (GRCh38)
Location 11:103929433-103929455
Sequence GAGGGCACTTTGGAGTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087926916_1087926919 -6 Left 1087926916 11:103929433-103929455 CCAATAAACTCCAAAGTGCCCTC 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1087926919 11:103929450-103929472 GCCCTCCACAAACCAGGAGAAGG 0: 1
1: 1
2: 5
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087926916 Original CRISPR GAGGGCACTTTGGAGTTTAT TGG (reversed) Intronic
900911163 1:5597899-5597921 CTGGGCACTTTGGGGTTAATGGG - Intergenic
901495899 1:9621707-9621729 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
903112957 1:21153030-21153052 GAGGGAACTTTGGAGCATTTAGG - Intronic
907444469 1:54499139-54499161 GATGGCACTTTGGATCTTACCGG + Intergenic
911246594 1:95525147-95525169 GAAGGCATTTTGGAGATAATTGG + Intergenic
911902303 1:103522153-103522175 GAGCACACTTTGGAGTGAATGGG + Intergenic
917150782 1:171942589-171942611 GTGGGCAATTTTGAATTTATGGG + Intronic
920733676 1:208512119-208512141 GAGGACACCTTGGAGTTCAGAGG + Intergenic
920772988 1:208907169-208907191 TAGGGCAGTTTGGAGGTTAAAGG + Intergenic
924563276 1:245174819-245174841 AAGGGCCCTTTGGAGCTTGTGGG + Intronic
1062772947 10:118784-118806 GAGGGACCTTTTGAGCTTATTGG - Intergenic
1064463590 10:15557831-15557853 GAGGCCACTTTGGAGAATAATGG - Intronic
1065185784 10:23170091-23170113 GAGGTCACTTTTCATTTTATGGG + Intergenic
1065493679 10:26307880-26307902 AAGGGCAGTTTGGAGATTACAGG - Intergenic
1066154776 10:32662915-32662937 CAGGGCACTTTGGAGGTGACTGG + Intronic
1067940771 10:50653810-50653832 GAGGGAAATTTGGAGCTTAGAGG - Intergenic
1068058786 10:52040094-52040116 GAAGGCACTATTGAGTTTAAAGG - Intronic
1069323730 10:67205194-67205216 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1069726639 10:70584374-70584396 GAGTGCAGTTTGGAGTGTAGTGG + Intergenic
1069888378 10:71637956-71637978 AAGGGCACATTGTAGTTTACAGG + Intronic
1070047379 10:72851902-72851924 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1074299405 10:112219791-112219813 AAGGGCATTTTGGAGGTTAAAGG - Intergenic
1074559045 10:114518904-114518926 GTGGGAACTTGGGAGTTTTTAGG + Intronic
1075637915 10:124042891-124042913 GAAGGCATCATGGAGTTTATAGG - Intronic
1078933491 11:15930995-15931017 GAGGGCTTTTCAGAGTTTATCGG - Intergenic
1079487596 11:20951729-20951751 GAGGCCACTTTGTAGTTTGTGGG + Intronic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1081446394 11:43135154-43135176 GAGGGCACTGCTGAGTGTATAGG + Intergenic
1081502032 11:43676476-43676498 GAGGGCACTGTGTAATTTAGAGG + Intronic
1084360018 11:68663221-68663243 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1087926916 11:103929433-103929455 GAGGGCACTTTGGAGTTTATTGG - Intronic
1090473155 11:126997779-126997801 CATGGCACTTAGGAGTTTCTGGG - Intronic
1090511010 11:127375115-127375137 GAGGGCAGTTTGGATGGTATAGG - Intergenic
1091049569 11:132355218-132355240 GAGGTCACCTTGGAGTATTTGGG - Intergenic
1094208397 12:27864591-27864613 GAGGAAACTTTGGAGGTGATCGG - Intergenic
1095765780 12:45893998-45894020 GAGGAAACTTAGGAGTTTATTGG + Intronic
1096180562 12:49548454-49548476 GAGGGCCTTCTGGAGTTGATGGG + Intronic
1096589991 12:52651762-52651784 GAGGCCGCTTTGGAGGTTTTGGG - Exonic
1097504265 12:60445244-60445266 AAGGGCAATTTGGAGGTTAAAGG - Intergenic
1098451526 12:70623602-70623624 TAGTGCACTATGGAGTTGATGGG - Intronic
1099607782 12:84827750-84827772 GTGGGGATTATGGAGTTTATGGG - Intergenic
1101219794 12:102626784-102626806 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1102993186 12:117329380-117329402 GAGGACACTTTGGGGTTCTTGGG + Intronic
1103466315 12:121144675-121144697 GAGGGCATTTAGGAGACTATTGG + Intronic
1106433871 13:29707208-29707230 GAGGGCAGTTAGGAGTCAATGGG - Intergenic
1106822730 13:33484130-33484152 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1107171323 13:37345497-37345519 GAGGGGTCTTTGAAGTTTCTTGG + Intergenic
1108688236 13:52839247-52839269 GACAGCACTTTGGACTTTAAAGG + Intergenic
1109232248 13:59772160-59772182 GATGACATTTTGGAGTTCATTGG - Intronic
1111239014 13:85450734-85450756 AAGGGCAGTTTGGAGTTCAAAGG - Intergenic
1112194326 13:97210111-97210133 GAGGACACTTTGGGTTTTTTTGG - Intergenic
1113433151 13:110267511-110267533 GAGAGCTCTTTGGAGTTTTCTGG - Intronic
1115290878 14:31770767-31770789 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1115646326 14:35370603-35370625 AGGGGCACTTTGGAGGTTAAAGG - Intergenic
1115704069 14:35980260-35980282 GAGGGCAACTTGGAGCTTTTAGG + Intergenic
1116064258 14:39962520-39962542 GAGGACACTTTGGGTTTTCTAGG - Intergenic
1121262902 14:92579401-92579423 AAGGGCAGTTTGGAGGTTAATGG + Intronic
1121705767 14:95992371-95992393 CAGGGCTCTTTGGAGGTTAAAGG + Intergenic
1125796815 15:42409473-42409495 GAGGTCACTTTGGACTTTGGTGG + Intronic
1129601935 15:77004220-77004242 GAGAGCCCTTTGCAGTTAATGGG + Intronic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1131426465 15:92349190-92349212 GATGGCACTTGGGAGTTTTGGGG - Intergenic
1132288366 15:100682266-100682288 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1133073051 16:3259374-3259396 GATGCCACTTTGGACTTTCTAGG + Intergenic
1135638123 16:24096336-24096358 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1135809436 16:25574163-25574185 AAGGGCAGTTTGGAGGTTAAGGG + Intergenic
1137364233 16:47846801-47846823 TAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1137374212 16:47938508-47938530 GAGGAATCTTTGGAGTTTCTAGG - Intergenic
1141200007 16:81890379-81890401 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1144009878 17:11136892-11136914 TAGGACACTCTGGAGTTTTTTGG - Intergenic
1144265830 17:13568633-13568655 GAGGTCAGTTTGGGGTTTGTTGG + Intronic
1147115923 17:38299694-38299716 GAGTTGACTTTGGAGTGTATAGG + Intronic
1147378748 17:40039445-40039467 GAGGGCACTTAGGAGTAGTTGGG - Intronic
1148413755 17:47489918-47489940 GAGTTGACTTTGGAGTGTATAGG - Intergenic
1150387892 17:64775177-64775199 GGGGGCACTGGGGAGTGTATAGG - Intergenic
1151241937 17:72764948-72764970 AAGGGCAGTTTGGAGGTTGTAGG - Intronic
1153711064 18:7799314-7799336 GGGGGCACTTGGGAGATGATTGG - Intronic
1154491758 18:14927697-14927719 CCAGGAACTTTGGAGTTTATGGG - Intergenic
1155143949 18:23068295-23068317 TAGGGCAATTTGGAGGTTAAAGG - Intergenic
1156362886 18:36399858-36399880 GAGGACAGTTTTGAGTTTAGAGG + Intronic
1157625647 18:49048596-49048618 GAGAGCAGTTTACAGTTTATTGG - Intronic
1157769063 18:50328664-50328686 GAGGGCACTTGGGGGTAAATGGG - Intergenic
1162759946 19:12882879-12882901 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
1168373815 19:55858869-55858891 GAGAGCACATTGGATTTTTTTGG + Exonic
928983710 2:37160066-37160088 GAGGGGACTTTGGATCTTCTTGG - Intergenic
929550783 2:42890186-42890208 GAGGGCAGTGTGGAGGTTAAAGG + Intergenic
929746912 2:44668499-44668521 GAGGGCACTGTGGAGTCAAGAGG - Intronic
930543879 2:52742865-52742887 CTGGGCACTTTGGAGATAATTGG - Intergenic
930621531 2:53649209-53649231 AAGGGCAATTTGGAGGTTAAAGG - Intronic
931608339 2:64074312-64074334 AAGGGCAGTTTGGAGATTAAAGG + Intergenic
931671998 2:64655023-64655045 CAGATCACTTTGGAGTTTAATGG + Intronic
931928640 2:67104156-67104178 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
932403554 2:71498762-71498784 AAGGGCATTTTGGAGATTAAAGG + Intronic
933859475 2:86450564-86450586 GAGGGCACTTTAGTCTTTATGGG + Intronic
934700566 2:96436505-96436527 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
936466631 2:112757832-112757854 GAGGGCACTTAGGATATAATAGG - Intronic
937149403 2:119675352-119675374 GAAGACTCTTTGGAATTTATGGG - Intergenic
937466383 2:122136484-122136506 GAGGGCATGCTGGGGTTTATTGG + Intergenic
937579327 2:123464752-123464774 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
939002332 2:136750636-136750658 AAGGGCTCTTTAGAGTTTACAGG + Intergenic
940509361 2:154593172-154593194 AAGGGCAGTTTGGAGGCTATAGG - Intergenic
942068734 2:172296173-172296195 GAGAGCACTGTGCAGTTTTTGGG - Intergenic
945332666 2:208557804-208557826 AAGGGCAGTTTGGAGTTTAAAGG + Intronic
946998732 2:225427937-225427959 GGGGACTCTTAGGAGTTTATAGG - Intronic
947304623 2:228730488-228730510 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
947950739 2:234145073-234145095 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
948020163 2:234725690-234725712 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
948194331 2:236084120-236084142 GAGGGAACTTTGGTGTTTACAGG - Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1170024532 20:11874418-11874440 GAAGGCACTTTGGAGCTGAAAGG - Intergenic
1170500390 20:16969787-16969809 CAGGACACTTTGAAGTTTAAAGG - Intergenic
1170865309 20:20150177-20150199 GAAGCCACTTTGGAGTGTAGGGG - Intronic
1170936107 20:20811110-20811132 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1172285321 20:33736339-33736361 AAGGGCAGTTTGGAGGTTAAAGG - Intronic
1172285642 20:33738525-33738547 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1172399621 20:34638579-34638601 GATGGAACTTTGGAGTCTTTAGG - Intronic
1172943539 20:38671143-38671165 GAGGGCACTGTGGACCTCATGGG - Intergenic
1173780799 20:45755595-45755617 AAGGTCACTTTGGATATTATGGG - Intronic
1173957245 20:47043215-47043237 GAGGCCACTTTTGTTTTTATTGG + Intronic
1174102973 20:48141279-48141301 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1184067073 22:42127117-42127139 GAGGGTACTGTGGAGCTTCTCGG - Intronic
1184069798 22:42140821-42140843 GAGGGTACTGTGGAGCTTCTCGG - Intergenic
951007672 3:17636859-17636881 TAGGTCACTTTTGAGTTTGTTGG - Intronic
952149618 3:30574234-30574256 GAAGCCACTTTGGAGATTAATGG - Intergenic
952505497 3:34003794-34003816 GATGGCACTTTAGTGCTTATTGG + Intergenic
953658171 3:44870687-44870709 GAGGTGACTTCGGGGTTTATTGG + Intronic
957774012 3:84732067-84732089 GAGGGGATTATGGGGTTTATGGG + Intergenic
960855963 3:122102525-122102547 GAGGACACTTTGGGGTTTGTGGG - Intronic
961045368 3:123704283-123704305 GAGGCCACTATGAACTTTATAGG - Intronic
962380673 3:134896207-134896229 GAGGGCACGAAGGAGCTTATGGG - Intronic
962384922 3:134925252-134925274 GTGAGCCCTTTGGAGTTGATGGG + Intronic
964453137 3:156831846-156831868 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
964494217 3:157271198-157271220 GAGGTCATATTGGACTTTATGGG + Intronic
969101230 4:4769603-4769625 GAGAGGACTCTGGAGTTTCTTGG + Intergenic
972876584 4:43369165-43369187 TAGGGCACCTTGCCGTTTATAGG - Intergenic
973016723 4:45149020-45149042 GATGTCACTTTGGACTATATAGG + Intergenic
975862706 4:78694355-78694377 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
978339697 4:107709351-107709373 AAGGGCAGTTTGGAGGTTAAAGG - Intronic
982124294 4:152171154-152171176 GAGGACACTTGGGAGTTGATGGG - Intergenic
986840113 5:11687123-11687145 GAAGCCAGTTTGGAGGTTATTGG - Intronic
988099906 5:26662206-26662228 GAGGGCACCTTGGACTTTCTGGG - Intergenic
988223086 5:28374883-28374905 GAAGGCAGTTTGGAGATTACTGG - Intergenic
990295520 5:54397923-54397945 GAAGGCATTTTGGAAATTATGGG - Intergenic
990634530 5:57709788-57709810 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
990744423 5:58944150-58944172 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
991611503 5:68454345-68454367 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
991997287 5:72400564-72400586 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
992594866 5:78335943-78335965 GAGGGCACTACGGAGTTAAAGGG - Intergenic
992612086 5:78516572-78516594 GAGGGCAATTTTGAATGTATAGG + Intronic
994585344 5:101701714-101701736 GCTGGCATTTTGGAGTTTATGGG - Intergenic
994784131 5:104133962-104133984 AAGGGCAATTTGAAGGTTATAGG - Intergenic
996925935 5:128826771-128826793 GAATGCACTTTTGAGATTATTGG - Intronic
997158651 5:131584388-131584410 GAGGGCAGTTTAGAGGTTAAAGG - Intronic
997823929 5:137089685-137089707 GATGGGACTTTGGAGTTGAGGGG - Intronic
999698480 5:154206912-154206934 GAGAGCAGTTTGGAGGCTATTGG + Intronic
999949217 5:156630688-156630710 AATGTCACTTTAGAGTTTATAGG - Intronic
1008445466 6:51584555-51584577 GAGGGCACTTCAGAGCTTAGTGG - Intergenic
1009161272 6:60285947-60285969 GAGGTCACATTGGAGTTGAGAGG - Intergenic
1009982602 6:70743268-70743290 GATGGCATTTTGAAGTTTGTGGG + Intronic
1013478472 6:110531195-110531217 CAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1013484997 6:110588563-110588585 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
1017920193 6:158865086-158865108 GAGGGCAGTGTGGAGCTTACAGG - Intergenic
1020680956 7:11235655-11235677 GTGGGGACTATGGAGATTATGGG - Intergenic
1020830620 7:13090188-13090210 GAGAGCTACTTGGAGTTTATAGG + Intergenic
1022504827 7:30903408-30903430 GCGGCCACTTTGCTGTTTATGGG + Intergenic
1023152550 7:37215606-37215628 CAGTGGGCTTTGGAGTTTATGGG - Intronic
1023523297 7:41071256-41071278 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
1023589334 7:41764578-41764600 CAGGGCATTTTGGAGGTAATAGG + Intergenic
1024790491 7:52959908-52959930 GAGGGCAATTAGGAGGTTAAAGG + Intergenic
1026274983 7:68868810-68868832 CAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1026361917 7:69609678-69609700 GAGTGAACTTTGGAGTATAGTGG + Intronic
1027161454 7:75805552-75805574 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
1029601322 7:101565125-101565147 GAGGCCATGTTGGAGGTTATGGG + Intergenic
1029985494 7:104919248-104919270 GAGGGAACTTTGTTGTGTATAGG - Intergenic
1031468480 7:122143121-122143143 GATGGCACTTTGGTGTTTCTGGG - Intronic
1031798666 7:126213597-126213619 GAGAGTACGTTAGAGTTTATGGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033640959 7:143263172-143263194 AAGGGCAGTTTGGAGGTTAAAGG + Intronic
1034349498 7:150406925-150406947 GAGGTCACTTTCAAGTTTACAGG + Intronic
1034399115 7:150849747-150849769 GAGGGCACTTTGCAGGGTGTGGG - Intronic
1034710015 7:153183084-153183106 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1034742989 7:153495584-153495606 GAGATCACTTTGGAGTTTTAAGG + Intergenic
1034915585 7:155035852-155035874 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1036525376 8:9529847-9529869 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1037836662 8:22218730-22218752 GAAGGGACTTTGGAGTCTTTTGG - Intergenic
1039184973 8:34906485-34906507 TAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1040137565 8:43872743-43872765 GAGAGCACTTTGGAGCTTATGGG + Intergenic
1041350227 8:56941029-56941051 TTGGGCAATTTGGATTTTATTGG - Intergenic
1043263006 8:78225624-78225646 GAGAGCAATTTGGAATTTCTAGG - Intergenic
1044304099 8:90617808-90617830 AAGGGCAATTTGGAGGTTAAAGG - Intergenic
1045585839 8:103536241-103536263 AAGGGCACTTTTGTGTGTATGGG + Intronic
1047053923 8:121143602-121143624 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1049449543 8:142653099-142653121 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1050366375 9:4877303-4877325 GGGGGCAGGATGGAGTTTATAGG - Intronic
1050501740 9:6305420-6305442 GAGGGCTCTTTGGGGGATATTGG + Intergenic
1052619792 9:30891545-30891567 AGGTGCACTTTGGAGTTTCTTGG + Intergenic
1055486554 9:76761783-76761805 GAGTGCTATTTGGAGTTTATGGG - Intronic
1056001585 9:82223026-82223048 GAGGGCACTTGGCAGTGTTTGGG - Intergenic
1056396294 9:86184364-86184386 GGGGGCACTGTGGTGTTTGTGGG + Intergenic
1057918579 9:99076744-99076766 GTGGGAACTTGGGGGTTTATGGG + Intergenic
1058223427 9:102330568-102330590 GAGGACATTTTGCAGTTTCTTGG + Intergenic
1058336416 9:103834853-103834875 GAGGGTAATTTGTAGTTCATGGG + Intergenic
1059819016 9:117951090-117951112 GAGGGCCTTTCTGAGTTTATTGG + Intergenic
1062668958 9:137695081-137695103 GATGGGAATTTGGAGTTTTTGGG + Intronic
1185631816 X:1520837-1520859 GGGGGTACTATGGAGATTATTGG - Intronic
1185946555 X:4383732-4383754 AAGGGCAGTTTGGAGATTAAAGG - Intergenic
1186788398 X:12974434-12974456 TAAGGTAATTTGGAGTTTATAGG - Intergenic
1187010004 X:15269031-15269053 GAGGAAACCTTGGAGTTTATCGG - Intronic
1187119038 X:16385403-16385425 GAGGCCATTTTGGACTTGATTGG - Intergenic
1188625667 X:32281621-32281643 TTAGGCACTTTGGAGTTTAGAGG - Intronic
1189419314 X:40842493-40842515 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1189961007 X:46324692-46324714 AAGGGCAATTTGGAGGTTAAAGG + Intergenic
1189985783 X:46552339-46552361 AAGGGCAGTTTAGAGTTTAAAGG - Intergenic
1190098125 X:47499100-47499122 AAGGGCAGTTTGGAGGTTAAGGG + Intergenic
1190408397 X:50110490-50110512 AAGGGCAGTTTGGAGGTTAGAGG + Intergenic
1194758239 X:97763102-97763124 AAGGGCAGTTTGGAGGTTAAAGG + Intergenic
1194958026 X:100203732-100203754 CAGAGAACTTTGGAGTTTACGGG - Intergenic
1195325890 X:103758076-103758098 AAGGGCAGTTTGGAGGTTAAAGG - Intergenic
1201166754 Y:11215909-11215931 GAGGAAACCTGGGAGTTTATGGG - Intergenic