ID: 1087933484

View in Genome Browser
Species Human (GRCh38)
Location 11:104004608-104004630
Sequence TGCAGTATTTTGAACTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087933484 Original CRISPR TGCAGTATTTTGAACTACAG GGG Intronic
904552923 1:31336021-31336043 TGCGGTATTATTACCTACAGAGG - Intronic
905438698 1:37978646-37978668 TGCAGAATTTTTAACCACAGTGG - Intronic
907180396 1:52564650-52564672 TGGAGTAGCTTAAACTACAGGGG - Intergenic
907259276 1:53205316-53205338 TGCAGAACTTTGAACTTGAGAGG + Intronic
910361253 1:86415404-86415426 TGAAGTATGTTGCATTACAGTGG + Intergenic
911627753 1:100145369-100145391 TACACTCTTTTGACCTACAGTGG + Intronic
912022738 1:105126061-105126083 TGCAGTATTTATAACTATATGGG + Intergenic
912769549 1:112451156-112451178 TGCAGTATTTAGAAATATGGAGG - Intronic
914398011 1:147289360-147289382 TGCGGTATTTTGAGGTACAAGGG + Intronic
919279072 1:195463244-195463266 TGTAGTATATTGTACTAGAGTGG + Intergenic
920691574 1:208150884-208150906 TGGAGAATTTTGAACTCCAAGGG + Intronic
921775611 1:219096700-219096722 TGTAGAATTTTGAACTTGAGAGG + Intergenic
1063361365 10:5462189-5462211 TGCAGTATTTTGAAAAGCAAAGG - Intergenic
1063399862 10:5732681-5732703 TGGAGTAGCTGGAACTACAGGGG + Intronic
1064735160 10:18374670-18374692 TGCAGAGTGTTGAACTACTGTGG - Intronic
1065040806 10:21693681-21693703 TGCTGTATTTTGAAATATAATGG - Intronic
1066461640 10:35617629-35617651 AGCAGTATTTTGTTCAACAGAGG - Intergenic
1068881271 10:62051662-62051684 TGAAGTATTTTGCACGACAAAGG + Intronic
1069047415 10:63757946-63757968 TGGAGTAGCTAGAACTACAGGGG + Intergenic
1069244262 10:66182616-66182638 TGCCGTATTTTGAAGTACATGGG - Intronic
1071231374 10:83590025-83590047 TGCAGTTATTTGAAATACTGTGG - Intergenic
1072774376 10:98174924-98174946 GGTTTTATTTTGAACTACAGAGG - Intronic
1073021590 10:100449237-100449259 TGCAGTGCTTTGTAATACAGCGG + Intergenic
1077820767 11:5737935-5737957 TCCAGTAATATGAAATACAGAGG + Intronic
1079972593 11:27054865-27054887 TGCAATATTCTGAATTACAGTGG + Intronic
1080054203 11:27888400-27888422 TGCAGAATTGTCAACTATAGGGG + Intergenic
1081944025 11:46972680-46972702 TCCTGCATTTTGAACTAGAGAGG - Intronic
1082045243 11:47720670-47720692 GGCAATATTTTGAATTACATAGG - Intronic
1085872320 11:80364828-80364850 TGCAGTGTTTAGAATTAGAGAGG + Intergenic
1087661182 11:100989903-100989925 TAAATTATTTTGAACCACAGAGG + Exonic
1087933484 11:104004608-104004630 TGCAGTATTTTGAACTACAGGGG + Intronic
1089803407 11:121058603-121058625 TCCAGGATTTGGAGCTACAGGGG - Intronic
1090814737 11:130282702-130282724 TGCAGTATTTTGAGTAAGAGTGG + Intronic
1092056103 12:5509625-5509647 TGCAGTCTTTGGAAGGACAGGGG + Intronic
1092944625 12:13441338-13441360 TGAAGTTTTTTGAAGTTCAGGGG + Intergenic
1093639139 12:21504881-21504903 TGGAGTATTCTGAACTTCTGGGG - Intronic
1093722520 12:22461314-22461336 TGCATTTTTTTAAACTGCAGGGG + Intronic
1094380338 12:29835952-29835974 TGCACTATGTTGAATAACAGTGG + Intergenic
1095499475 12:42820751-42820773 GGGAGTATTTTGCACTGCAGTGG + Intergenic
1100718973 12:97336780-97336802 TGTAGTTTTTTTAAGTACAGCGG + Intergenic
1106404564 13:29462586-29462608 TGCAGTAATTTGAAAGTCAGTGG + Intronic
1106823923 13:33498395-33498417 TGCAATATTCTGAAATAAAGAGG - Intergenic
1108626623 13:52235219-52235241 TGAAATATTTTTAACTGCAGAGG - Intergenic
1108659447 13:52571272-52571294 TGAAATATTTTTAACTGCAGAGG + Intergenic
1109554160 13:63948862-63948884 TGCTGTAGTTTGAATTTCAGTGG + Intergenic
1109813825 13:67552009-67552031 TGCAGGATTGTGAGCCACAGGGG - Intergenic
1110870432 13:80446246-80446268 TGCAGTATTTACTACTACAGTGG + Intergenic
1112028214 13:95432196-95432218 TGAAGTTTTTTGAAGTAAAGGGG + Intergenic
1112828027 13:103414513-103414535 GCCAGTGTTTTGAACTGCAGGGG - Intergenic
1112881999 13:104119806-104119828 TGCAGCTTTTTGAACTACTGGGG + Intergenic
1113289310 13:108887225-108887247 TGCAGACTTTTGAACTACTGGGG - Intronic
1120991390 14:90380551-90380573 GACGGTATCTTGAACTACAGTGG + Intergenic
1121630083 14:95415523-95415545 TGCAGAATTGGCAACTACAGGGG - Intronic
1123431514 15:20221196-20221218 TCCAGAATGATGAACTACAGTGG - Intergenic
1125887523 15:43239789-43239811 TGAAGGATTTTTAACTTCAGTGG - Intronic
1126511607 15:49481593-49481615 TGCAGAATTTTGAAGAACACAGG - Intronic
1127553871 15:60067985-60068007 TTCAGTAACTTGAACTAGAGTGG - Intergenic
1128713255 15:69887820-69887842 AGCTGTATCTAGAACTACAGTGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1130943368 15:88530725-88530747 TCCAGTATTTTGACCAACTGCGG - Exonic
1131701357 15:94940129-94940151 TAAAGTATTTTCAACTACAGTGG - Intergenic
1135094148 16:19549974-19549996 TTCATTATTTTGAACTATTGAGG + Intronic
1135284112 16:21178723-21178745 TGAAGTCTTTTGAAGTATAGTGG - Intronic
1146075813 17:29727789-29727811 AGCACTATTTTGAATAACAGTGG - Intronic
1146570232 17:33946155-33946177 TGCAGGATCTTGAGCTGCAGTGG - Intronic
1146763009 17:35495022-35495044 TGGAGTAGCTGGAACTACAGGGG + Intronic
1149106147 17:52968530-52968552 TGAAGTATTTTGATATAAAGGGG - Intergenic
1150688801 17:67344950-67344972 TGCTGTATTCTGAACTACTGTGG - Intronic
1151189215 17:72385951-72385973 TGCAGAATTGATAACTACAGTGG - Intergenic
1155719443 18:28992699-28992721 AACAGCAGTTTGAACTACAGTGG + Intergenic
1159634514 18:70788925-70788947 TGCAATACTTTGAACTAAAATGG - Intergenic
1164863168 19:31579889-31579911 TGCAGTATTTTCAACTGAAAAGG + Intergenic
1165852377 19:38857057-38857079 TGCAGTATTTTGAGATAGTGGGG - Intergenic
1167397667 19:49242123-49242145 TGCAGTATTTAGGAGTAAAGGGG - Intergenic
925357876 2:3255082-3255104 AGCAATACTTTGAACAACAGAGG + Intronic
925424838 2:3740138-3740160 TGCAGAATTTATATCTACAGGGG - Intronic
926737583 2:16085206-16085228 TGCAAGATTCTGAACTAGAGGGG + Intergenic
927818668 2:26243945-26243967 TATAGTATTTTGAATTTCAGCGG - Intronic
928369365 2:30729975-30729997 TCCAGTATTTTTTTCTACAGTGG + Intronic
929168848 2:38910859-38910881 TACAGTACTTTGAAATACTGTGG + Intronic
930185079 2:48405272-48405294 TGGAGAACTTTGAACTAAAGAGG - Intergenic
930412244 2:51039785-51039807 TGCAATATCTTGAAATAGAGAGG + Intergenic
935106409 2:100048675-100048697 TGCAGTATTTGGAACAAAAACGG - Intronic
936471170 2:112799770-112799792 TGCAGTATTTAAAACCAGAGGGG + Intergenic
937370255 2:121292629-121292651 TGCTGGATTGTGAAGTACAGTGG + Intergenic
939287230 2:140147771-140147793 TGCAGTAATATTATCTACAGTGG - Intergenic
942040716 2:172059493-172059515 TGGAGGATTTTGAGCTACAGTGG - Intronic
942474030 2:176296324-176296346 GGCAGTATTTAAAAATACAGAGG - Intronic
944146351 2:196511386-196511408 TGCTGTATTGTGTACTGCAGAGG + Intronic
944822791 2:203447941-203447963 TGAAGCATTTTGAACTACCTGGG + Exonic
946261855 2:218499464-218499486 TAAAGTATTTAGAACTAAAGGGG - Intronic
947014842 2:225607872-225607894 TGCACTATTTTGAAGTAAAAAGG + Intronic
1169989054 20:11479611-11479633 AGCACTATTTTGAATAACAGTGG - Intergenic
1172453904 20:35050842-35050864 TGCAGTATTGTCAAGTGCAGTGG + Intronic
1175015363 20:55784382-55784404 TGAAGGATTGTGAACTTCAGGGG - Intergenic
1176907977 21:14527059-14527081 TGCAGTACTTTGAAATATACTGG + Intronic
1178160801 21:29911983-29912005 TGAAGTATTTAGAATTAAAGGGG + Intronic
1181865760 22:25853623-25853645 TGCACCATTTTCAACCACAGAGG - Intronic
1182389361 22:29978820-29978842 TGCTGTGTTTTCAACTTCAGTGG + Intronic
1182506133 22:30784080-30784102 TGCAGTATTTTAAAAAACAGAGG - Intronic
949464001 3:4325213-4325235 TGAAATATTTTGAAGAACAGGGG - Intronic
950355371 3:12403831-12403853 TACTGTATTTTGAAATACAATGG - Intronic
950593242 3:13954618-13954640 TGAAGTGTTTTGAACAACAGTGG + Intronic
952576378 3:34779070-34779092 TGCCTAATTTTGAACTACATAGG - Intergenic
953188721 3:40663530-40663552 TGCAGTATGTTGTCCTACACCGG + Intergenic
956428798 3:69164097-69164119 CAGAGTATTTTGGACTACAGGGG + Intergenic
957877971 3:86174094-86174116 AGCAGCATTTTAAGCTACAGGGG + Intergenic
958140620 3:89557891-89557913 TTCAGTATTTTTAGATACAGAGG + Intergenic
958600411 3:96289371-96289393 TGCTGGATTTTGGACTTCAGTGG + Intergenic
959281369 3:104345927-104345949 TACAGCATCTTGAGCTACAGAGG - Intergenic
960372835 3:116862186-116862208 TTCAGCATTTTGAATTTCAGGGG - Intronic
960602522 3:119471812-119471834 TTCAGTATCTAGAACTACACTGG - Intronic
961112884 3:124299885-124299907 TGCAGGAGTTTGAAATACAATGG - Intronic
961483776 3:127202021-127202043 TGCAGAATTTTTAAGTACATGGG - Intergenic
962717383 3:138138361-138138383 TGCAGTAGTTTGTAATACAGGGG + Intergenic
962872521 3:139509966-139509988 TTCCGTACTTTGATCTACAGTGG + Intergenic
964454783 3:156850896-156850918 TGCAGTATTTTTAAAATCAGGGG + Intronic
965488944 3:169313300-169313322 TGCAGTGTTTTGCTCTAAAGAGG + Intronic
965858465 3:173117781-173117803 GGCAATATTTTGAATTCCAGTGG + Intronic
967541736 3:190676045-190676067 TGGAGTAGCTGGAACTACAGGGG + Intergenic
969333620 4:6494221-6494243 TGCAGTATCTAGAAACACAGGGG + Intronic
971036278 4:22696367-22696389 AACTGTATTTTGAAATACAGTGG - Intergenic
972001252 4:34037932-34037954 TGCAGTATTTTTTACTATAATGG - Intergenic
973726312 4:53780346-53780368 TGCAGTTTATTTAACTAGAGTGG + Intronic
973943783 4:55937031-55937053 AGCACTATGTTGAACAACAGTGG + Intergenic
974681836 4:65174695-65174717 TGCAATATTTTTAACTATATTGG + Intergenic
976384419 4:84439037-84439059 TGCAGTGTTTAGAATTGCAGGGG + Intergenic
977363856 4:96041560-96041582 TTAAGTCTTTAGAACTACAGTGG - Intergenic
979115904 4:116822079-116822101 TACTGGATTTTGTACTACAGTGG + Intergenic
980066815 4:128198186-128198208 TGCAGCATATTAAACTACAATGG - Intronic
980214128 4:129829507-129829529 TGAAGGATTTTGAAGTACAGTGG + Intergenic
980672721 4:136030673-136030695 TGTAGTATTTTTCAATACAGGGG + Intergenic
980883880 4:138741005-138741027 TGCAGTATCCTGAAATACACAGG + Intergenic
983464071 4:168064552-168064574 TGCAGTATTTTAACTTAAAGAGG - Intergenic
983519495 4:168692195-168692217 TGCAGTAATCTGACCTGCAGTGG - Intronic
983701776 4:170605508-170605530 TGCAGAATTGGCAACTACAGGGG - Intergenic
986908656 5:12526410-12526432 TTGAGTATTTTGAACTACAAAGG - Intergenic
989090128 5:37721728-37721750 TTCAGACTTTTGAAATACAGTGG - Intronic
989803377 5:45573272-45573294 TTCAGATTTTTGAACTGCAGTGG - Intronic
990202727 5:53396572-53396594 TGCACTATGTTGAATAACAGTGG + Intergenic
990272214 5:54155182-54155204 GGCAATATTTTGAAGTAAAGGGG - Intronic
990789291 5:59458446-59458468 TGAAGGATTTTGAACTGCAGAGG + Intronic
993100815 5:83537754-83537776 TGCAGAACTTGGAACTATAGTGG - Exonic
998018512 5:138751858-138751880 CACAGTACTTTGAATTACAGTGG + Intronic
1000427391 5:161107986-161108008 TCCAGTATTGTTAACTATAGAGG - Intergenic
1000974301 5:167748502-167748524 TTCAGTAGTTGGAACTACATGGG + Intronic
1001874815 5:175190696-175190718 CCCAGTAATTTGGACTACAGGGG - Intergenic
1005304613 6:24501307-24501329 TGCAGAATTGGCAACTACAGGGG - Intronic
1007082358 6:39116747-39116769 TGTAGTAGTTTGAGCTAGAGTGG + Intergenic
1008648464 6:53540592-53540614 TATAGTATTGTTAACTACAGGGG - Intronic
1011789046 6:90878533-90878555 TTTAGCATTTTTAACTACAGGGG + Intergenic
1013982836 6:116153451-116153473 TCTATTATTTTGAACTCCAGTGG - Intronic
1014254051 6:119143854-119143876 TTCAGTATTGTTAACTACACTGG - Intronic
1014429503 6:121350946-121350968 TGTAGTATTTAAAAATACAGAGG + Intergenic
1014463053 6:121721402-121721424 TACTTTATTCTGAACTACAGAGG + Intergenic
1015171753 6:130261900-130261922 TGCAGTTCTTTGAACCACTGTGG - Intronic
1017316659 6:153038821-153038843 TGCACTGTTTTGAATTACAGAGG + Intronic
1017799885 6:157885426-157885448 TTCCGTATTTTGAGCTAAAGTGG + Intronic
1018579960 6:165300437-165300459 TGCAGTCTGTTGAACTGCTGGGG + Exonic
1018615351 6:165681696-165681718 TGAAGTGTTTTGAAATACACTGG + Intronic
1018884945 6:167927473-167927495 TGCAGGATTTAGAACAAAAGAGG + Intronic
1020195204 7:6032782-6032804 AACAGTATTTTTAACTACACAGG + Intronic
1021391176 7:20094827-20094849 GGCAATAATTTGAATTACAGAGG - Intergenic
1028694125 7:93688793-93688815 TGCCTAATTTTGACCTACAGAGG - Intronic
1029357572 7:100063610-100063632 TGCAGTATTGTAAACTAGATTGG + Intronic
1029618500 7:101675214-101675236 TGCAATTGTTTGAACTTCAGAGG - Intergenic
1031138040 7:117907292-117907314 TGCAGAATTTTGAGCTGGAGAGG - Intergenic
1032814406 7:135457041-135457063 GCTAGTATTTTGAAATACAGTGG - Intronic
1038821438 8:30955644-30955666 TCCAGTATCTAGGACTACAGGGG + Intergenic
1039222501 8:35349741-35349763 TGCAGCATATTGAAGTACAGTGG - Intronic
1041014224 8:53574789-53574811 TGCAATATTTTGAATAGCAGTGG - Intergenic
1041135866 8:54758396-54758418 TGCTCTATTTTCATCTACAGAGG + Intergenic
1042434823 8:68751449-68751471 TGCAGTCTTTTCAAGCACAGGGG - Intronic
1043796260 8:84545194-84545216 GGCAGGATTTTAAACTATAGAGG - Intronic
1044252745 8:90023302-90023324 TGTAGTATTTAGAAATACAATGG + Intronic
1048543318 8:135363027-135363049 TGCAGTTTGTTGAATTAAAGTGG - Intergenic
1048618535 8:136106176-136106198 TGGAGTATTCTGAAATAAAGGGG + Intergenic
1050622487 9:7468814-7468836 TGGAGTATTTTGAACCAAATGGG - Intergenic
1053611508 9:39718548-39718570 TGCAGTATCTTGATATATAGAGG - Intergenic
1053869541 9:42476603-42476625 TGCAGTATCTTGATATATAGAGG - Intergenic
1054086747 9:60752612-60752634 TGCAGTATCTTGATATATAGAGG + Intergenic
1054242013 9:62623837-62623859 TGCAGTATCTTGATATATAGAGG + Intergenic
1054556136 9:66658355-66658377 TGCAGTATCTTGATATATAGAGG + Intergenic
1056705686 9:88950913-88950935 TGCAGTATTTTGACTTTTAGTGG - Intergenic
1058066589 9:100555054-100555076 TGCAGTGTTTTCAAATACAAAGG - Intronic
1058855108 9:109054017-109054039 TGTTGTATTTAGAAATACAGTGG - Intronic
1058901003 9:109442171-109442193 CCCAGTAACTTGAACTACAGGGG + Intronic
1059715929 9:116913293-116913315 AGCAGAATTTTGAAATCCAGAGG - Intronic
1060454912 9:123783034-123783056 TGTAGTATTTTGTATTACTGCGG - Intronic
1060644047 9:125262691-125262713 AGCAGGACTTTGAACTAGAGAGG + Intronic
1186497783 X:10025447-10025469 TGGAGTATTCAGAACTACATAGG - Intronic
1186690718 X:11972542-11972564 TGTAGTATTTTGAAGCACAGGGG + Intergenic
1186904652 X:14098342-14098364 TTCAGTATCTGGAACTACAGGGG + Intergenic
1188594185 X:31876858-31876880 TGTAATATTTTGTATTACAGTGG - Intronic
1189063210 X:37776764-37776786 GGCAGAATCTTGAGCTACAGTGG + Intronic
1193094895 X:77536783-77536805 TTCAGTCTTTTGAATTTCAGAGG + Intronic
1193778839 X:85678002-85678024 TGCAATATCTTGATCTACATTGG + Intergenic
1194514702 X:94837850-94837872 TCCAGTATGTTGAATAACAGTGG + Intergenic
1196338089 X:114563017-114563039 TGCAGTATGTTCTACAACAGAGG + Intergenic
1198978815 X:142369577-142369599 CCCAGTATTTGGGACTACAGGGG - Intergenic
1199568573 X:149244802-149244824 AGTAGTATGTTGAACAACAGTGG + Intergenic
1200458537 Y:3423997-3424019 TGTAATGTTTTCAACTACAGAGG - Intergenic