ID: 1087940319

View in Genome Browser
Species Human (GRCh38)
Location 11:104088844-104088866
Sequence AGAACCTCCCTGGGTATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087940319_1087940329 30 Left 1087940319 11:104088844-104088866 CCCTCTATACCCAGGGAGGTTCT 0: 1
1: 0
2: 1
3: 5
4: 122
Right 1087940329 11:104088897-104088919 ATAAGCATGAACAACAAAGTGGG 0: 1
1: 0
2: 2
3: 61
4: 938
1087940319_1087940328 29 Left 1087940319 11:104088844-104088866 CCCTCTATACCCAGGGAGGTTCT 0: 1
1: 0
2: 1
3: 5
4: 122
Right 1087940328 11:104088896-104088918 CATAAGCATGAACAACAAAGTGG 0: 1
1: 0
2: 1
3: 20
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087940319 Original CRISPR AGAACCTCCCTGGGTATAGA GGG (reversed) Intronic
901798230 1:11692444-11692466 AGTACCTTCCTGGGCACAGATGG - Intronic
901885050 1:12216833-12216855 AGGACCAGCCTGGGTAGAGAAGG + Intergenic
903101731 1:21035790-21035812 AGAACCTCCCTGGCAAAAGGTGG - Intronic
907647070 1:56254818-56254840 AGAACGTTCCTGGGTATGGCAGG - Intergenic
912598621 1:110904177-110904199 GGAACCACCCAGGGTCTAGAGGG + Intergenic
913177713 1:116290264-116290286 AGAAGCTACCTGGTCATAGAGGG + Intergenic
915049754 1:153056403-153056425 AGAAGCTCCCTGTGTATCCATGG + Exonic
918047389 1:180949612-180949634 AGGCCCTGCCTGGGTCTAGAAGG - Exonic
919768819 1:201144235-201144257 AGAGGCTCCCGGGGTAGAGATGG + Intronic
924657334 1:245984849-245984871 AGAACCTACATGTGTACAGAAGG - Intronic
1068761477 10:60715497-60715519 AGACCCTTCCTGGGTAGATAAGG + Intronic
1071443267 10:85723187-85723209 AACACCTCCCTGGGGATAGGAGG - Intronic
1073256023 10:102151901-102151923 AGGGCCTCCCTGGGTATTGGAGG + Intergenic
1074662968 10:115683432-115683454 AAAAACTCTCTAGGTATAGAAGG - Intronic
1075873113 10:125785560-125785582 ACAACTTCCCTGTGAATAGAAGG - Intronic
1076049558 10:127321595-127321617 AGCACCTCCTTGGGGATAGGAGG - Intronic
1081529046 11:43945361-43945383 AGAAACTCCCTGAGGACAGAGGG + Intergenic
1084907558 11:72359961-72359983 AGGACCACCCTGGGTAAACAGGG - Intronic
1087940319 11:104088844-104088866 AGAACCTCCCTGGGTATAGAGGG - Intronic
1088514722 11:110618123-110618145 AGAACATCTCTGGATATACAGGG + Intronic
1088788354 11:113202494-113202516 AGAAACTCACTGGGTAGAGCAGG + Intronic
1089004712 11:115081771-115081793 ACAACATCCCTGGTGATAGAAGG - Intergenic
1089331453 11:117691789-117691811 AAAACCCCCCTGGGGAGAGAAGG - Intronic
1090270968 11:125385940-125385962 AGTGCCACCCTGGGCATAGATGG - Intronic
1106522252 13:30508117-30508139 AGAACCTGCCTGGGGAAATAAGG - Intronic
1108169693 13:47728252-47728274 GGAACCTTCTTGGGCATAGATGG + Intergenic
1108804243 13:54134332-54134354 TGAAGCTCACTCGGTATAGAAGG + Intergenic
1112447807 13:99481501-99481523 AGAACCTCTCAGGGAATAAAAGG + Intergenic
1113160623 13:107376589-107376611 AGCAACTCCCTGGGGAGAGATGG - Intronic
1114616217 14:24069673-24069695 AGAGAGTCCCTGGGGATAGAGGG - Exonic
1115871837 14:37813357-37813379 AGAACCTCCCTGTTTGTAGTAGG + Intronic
1118211146 14:63766774-63766796 AAAACCTCTCTGGGGAGAGAGGG + Intergenic
1120302779 14:82729486-82729508 AGAACCTACTGGGGTATGGAGGG + Intergenic
1127561490 15:60141518-60141540 GGAACCTCCTTGGCTAGAGATGG - Intergenic
1128517355 15:68351028-68351050 AGACCCTCCCTGGCAATGGATGG + Intronic
1131517247 15:93087880-93087902 AGAAGCTCTCTGAGTATCGACGG - Intronic
1133033693 16:3023353-3023375 AGAGGCTCCCTGGGGAGAGATGG + Exonic
1136078234 16:27831617-27831639 GGAACTTCCCTGGGGAGAGAGGG + Intronic
1138224287 16:55279274-55279296 CAAACCTCACTGGGCATAGAGGG + Intergenic
1139122964 16:64042888-64042910 CCATCCTCCCTGGGTATAGCTGG - Intergenic
1141850901 16:86645381-86645403 AGAACCTCCTAGGTTTTAGAGGG + Intergenic
1148062674 17:44847513-44847535 AGAACCTGCCTGGAAAGAGATGG + Intronic
1148153658 17:45410784-45410806 ACACCCTCCCTGGGCCTAGAGGG - Intronic
1149389068 17:56171404-56171426 AGAGCCTCCTGGGGTATAGAAGG - Intronic
1154370918 18:13762454-13762476 AGAACCTGGCTGGGTACTGAAGG - Exonic
1156089856 18:33454279-33454301 TGAACCTCTTTGGATATAGAAGG - Intergenic
1158886272 18:61830004-61830026 AGAAGCTCTCTGGAAATAGATGG - Intronic
1159426499 18:68295421-68295443 AGCTCCTCCCTGGAGATAGAAGG - Intergenic
1162835837 19:13317317-13317339 AGAACCTGCCAGGGAAAAGATGG + Exonic
1164742936 19:30590135-30590157 AGAACCTCCATGGGTTGACATGG - Intronic
1166420116 19:42630173-42630195 TGAGGCTCCCTGGGCATAGAAGG - Intronic
925275659 2:2646204-2646226 AGAACCTCGCATGGCATAGATGG + Intergenic
927583932 2:24281911-24281933 AGAATCTTCCTGGGTAGAGGAGG - Intronic
931628425 2:64277501-64277523 AGAGCCTCCCTGGCTGGAGAAGG - Intergenic
932880991 2:75501886-75501908 AGAACCTGCCTAGGTTCAGAAGG + Intronic
934558989 2:95302549-95302571 AGACCCTCCCTGGGATCAGAAGG + Intronic
934728790 2:96642925-96642947 AGAGCCTCCCTGGGTCCACATGG + Intergenic
935245417 2:101215025-101215047 AGAACCTCACCGGGAATATAGGG + Intronic
935537484 2:104310903-104310925 GAAACCTCCATGGGTATGGAGGG - Intergenic
935893288 2:107704236-107704258 AGAACCCTCCTGGGTAAGGAAGG + Intergenic
936114414 2:109690727-109690749 AGAAACACCTTGGGTATGGAAGG + Intergenic
940715634 2:157220158-157220180 AGAACCTCAATGGGTCCAGAAGG - Intergenic
940892521 2:159048757-159048779 AGAACCTTTTTGGGTATAGGCGG + Intronic
940912281 2:159219165-159219187 GAAACCTGCCTGGGTATAGCAGG + Intronic
944246335 2:197533947-197533969 AGAACCAAGCTGGGTCTAGAAGG + Intronic
945581119 2:211595894-211595916 AATCCCTCCCTGGATATAGAGGG + Intronic
946295401 2:218779868-218779890 AGAACTTTCCTGGGTATAGCAGG - Intergenic
946330894 2:219008856-219008878 AGAGGCTCTCTGGGTAGAGAAGG - Intronic
946861975 2:224008962-224008984 CGAGCCTCCCTCGGTCTAGATGG - Intronic
948731263 2:239965233-239965255 AGAACCCTCCTGGGTATCAAAGG - Intronic
1171011694 20:21512658-21512680 GGGACCTCCCAGGGTAAAGAGGG + Intronic
1173298794 20:41782337-41782359 GGGCCCTCCCTGGGAATAGAGGG - Intergenic
1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG + Intergenic
1178025311 21:28459533-28459555 AGATCCTGCCTGGGTATACTGGG - Intergenic
1178223552 21:30688554-30688576 AGAACCGCCCAGGCTACAGAGGG - Intergenic
1184032787 22:41904795-41904817 AGAGCTACCCTGGGCATAGATGG + Intronic
1184206212 22:43005393-43005415 ATATCCTCCCTGGGTTTTGAGGG - Intronic
1184991373 22:48172400-48172422 AGAACCTGCTTGGGTTTTGATGG - Intergenic
957244812 3:77703213-77703235 ACAACCTCCGAGGGTATTGAAGG + Intergenic
957406337 3:79778020-79778042 GGAAGCTCCCAGAGTATAGAAGG - Intergenic
959548780 3:107630086-107630108 AGAACCGCTATGGATATAGAAGG - Intronic
960246932 3:115409998-115410020 AGAATCACCATGGGTATAAATGG + Intergenic
961252372 3:125518501-125518523 GGAACATACCTGGGTATATAAGG - Intronic
962735464 3:138321690-138321712 AGAACCAAGCTGGGTATAGGAGG + Intronic
963271467 3:143289814-143289836 AGAACCTCTCTGGCTATGAATGG - Intronic
964938433 3:162123677-162123699 AGTATCTCCCTGGATCTAGAAGG - Intergenic
967009984 3:185423616-185423638 AGAAGCTCCCTGGGAATATAAGG - Intronic
967425130 3:189318127-189318149 GATACCTCCCTGTGTATAGAAGG - Intronic
973636197 4:52863386-52863408 AGAACCTCCCTGGGAAGCGCTGG - Intronic
976622260 4:87141108-87141130 TGAAACTCCTTGGCTATAGATGG - Intergenic
977433964 4:96969224-96969246 AGAAACTCCATGGGTAAAGTTGG + Intergenic
982817903 4:159908803-159908825 AGAACTTCCCTGGATAGAGGAGG + Intergenic
986546769 5:8906146-8906168 AAAACCTCAGTGGGTAGAGAGGG - Intergenic
988117865 5:26920118-26920140 TGAACCTGCCTGGGGACAGAAGG + Intronic
993870814 5:93252265-93252287 AGATCCTCTCTGGGTATAAAAGG + Intergenic
995605122 5:113845874-113845896 AGAATATCCCTGGGGATGGAGGG - Intergenic
996083133 5:119276871-119276893 AGATCCTCCCTGTGTAAAGGAGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998668388 5:144325318-144325340 AGAACCTCCCTGTGTCTAATAGG + Intronic
1004020964 6:11775239-11775261 TGAACTTCTCTGGGTAGAGAAGG - Intronic
1004132119 6:12930368-12930390 AGAACCTCTTTGGGGATACATGG + Intronic
1005703722 6:28430207-28430229 GGAATCTCCCTGAGGATAGAGGG - Intergenic
1007496293 6:42262094-42262116 CGAACTTCCCTGGGCAAAGAGGG + Intronic
1007574480 6:42916192-42916214 TGGACCTCCCTGGGTACTGATGG + Intronic
1009627577 6:66155675-66155697 AGGACTTTCCTGGCTATAGAGGG + Intergenic
1010420931 6:75674307-75674329 AAAACTTACCTAGGTATAGATGG - Intronic
1010656546 6:78518309-78518331 AGATCCCTCCAGGGTATAGAGGG + Intergenic
1014009370 6:116458805-116458827 AGAACAGACCTGGGTATGGAGGG + Intergenic
1017536316 6:155350560-155350582 ACCACCTCCCTGGGTAGAGGAGG + Intergenic
1035094196 7:156340308-156340330 AGAACCTGCCTGAGGACAGAAGG - Intergenic
1035165877 7:156989612-156989634 AGAACATGCATGGGTATAAATGG - Intergenic
1035281822 7:157783399-157783421 TGAACCTTCCTAGGTATGGATGG - Intronic
1035674810 8:1449211-1449233 AAAACCTCCCTGGCAATAGGAGG - Intergenic
1039709478 8:40041524-40041546 AGGACCTCCCCCGGTAGAGAAGG + Intergenic
1044325742 8:90855573-90855595 AGATCCTTCCTGATTATAGATGG - Intronic
1046363672 8:113196289-113196311 AAAAACTCACTGGGTAAAGATGG + Intronic
1055132545 9:72792963-72792985 ACCACTTCCCTGGGCATAGAAGG - Intronic
1057408836 9:94798343-94798365 AGAATCTCTCTGGGCATAAAAGG - Intronic
1058277488 9:103063320-103063342 AGAACCTCCCTGGAGAGAGTAGG + Intergenic
1058636260 9:107041438-107041460 AGAATTTCCCTGGGTGGAGAAGG - Intergenic
1061152039 9:128834308-128834330 AGTCCCTCCCTGGGTATAGAGGG + Intronic
1061432038 9:130537171-130537193 AGACCCTTCCTGGTTTTAGATGG + Intergenic
1187478425 X:19632588-19632610 GGAACCTCCCTATGCATAGATGG + Intronic
1189019413 X:37319005-37319027 AGAAGCTCACTGTGTAGAGAGGG - Intergenic
1189130363 X:38491871-38491893 AGAACCTTCATGGGCATATATGG + Intronic
1192536591 X:71933787-71933809 TGAACCTGCCTGGGGATAGCTGG - Intergenic
1197911966 X:131492630-131492652 AGAACCCCACTGGGGATAAAGGG - Intergenic
1198328075 X:135594404-135594426 GGAACCTACCTGGGGATGGAGGG + Intergenic
1198399800 X:136257775-136257797 AGAAGCCCCCTGGGTACTGAAGG + Intergenic