ID: 1087946431

View in Genome Browser
Species Human (GRCh38)
Location 11:104165099-104165121
Sequence GAGCAGGAACAGACTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087946423_1087946431 15 Left 1087946423 11:104165061-104165083 CCCTTCCACAGGAAAGGGCAACA No data
Right 1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG No data
1087946422_1087946431 19 Left 1087946422 11:104165057-104165079 CCAGCCCTTCCACAGGAAAGGGC No data
Right 1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG No data
1087946426_1087946431 10 Left 1087946426 11:104165066-104165088 CCACAGGAAAGGGCAACAGGACA No data
Right 1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG No data
1087946424_1087946431 14 Left 1087946424 11:104165062-104165084 CCTTCCACAGGAAAGGGCAACAG No data
Right 1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087946431 Original CRISPR GAGCAGGAACAGACTGAGCA AGG Intergenic
No off target data available for this crispr