ID: 1087951480

View in Genome Browser
Species Human (GRCh38)
Location 11:104225709-104225731
Sequence CTGTATTAGCAGGAGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087951480_1087951483 7 Left 1087951480 11:104225709-104225731 CCTTTTTGCTCCTGCTAATACAG No data
Right 1087951483 11:104225739-104225761 TTCATCTTACATTTTAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087951480 Original CRISPR CTGTATTAGCAGGAGCAAAA AGG (reversed) Intergenic
No off target data available for this crispr