ID: 1087955564

View in Genome Browser
Species Human (GRCh38)
Location 11:104282785-104282807
Sequence CAGGGGTAATGGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087955564_1087955575 19 Left 1087955564 11:104282785-104282807 CCTTATTCCCTCCATTACCCCTG No data
Right 1087955575 11:104282827-104282849 ATTCTGCTCTCTACATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087955564 Original CRISPR CAGGGGTAATGGAGGGAATA AGG (reversed) Intergenic
No off target data available for this crispr