ID: 1087955682

View in Genome Browser
Species Human (GRCh38)
Location 11:104284879-104284901
Sequence CCGTAGATCTATTCTATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087955682_1087955686 30 Left 1087955682 11:104284879-104284901 CCTGTGATAGAATAGATCTACGG No data
Right 1087955686 11:104284932-104284954 TCTTCCAACGGTGCTTTTTGTGG No data
1087955682_1087955685 18 Left 1087955682 11:104284879-104284901 CCTGTGATAGAATAGATCTACGG No data
Right 1087955685 11:104284920-104284942 TAAATTAGACATTCTTCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087955682 Original CRISPR CCGTAGATCTATTCTATCAC AGG (reversed) Intergenic
No off target data available for this crispr