ID: 1087956157

View in Genome Browser
Species Human (GRCh38)
Location 11:104290105-104290127
Sequence GTGGACAACCTGAATGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087956157_1087956166 26 Left 1087956157 11:104290105-104290127 CCAAGCTCATTCAGGTTGTCCAC No data
Right 1087956166 11:104290154-104290176 CTGAGGTCCTCAACTTCTATAGG No data
1087956157_1087956162 9 Left 1087956157 11:104290105-104290127 CCAAGCTCATTCAGGTTGTCCAC No data
Right 1087956162 11:104290137-104290159 TCCCCGTGGTTGTAGGACTGAGG No data
1087956157_1087956161 2 Left 1087956157 11:104290105-104290127 CCAAGCTCATTCAGGTTGTCCAC No data
Right 1087956161 11:104290130-104290152 GATTTATTCCCCGTGGTTGTAGG No data
1087956157_1087956159 -5 Left 1087956157 11:104290105-104290127 CCAAGCTCATTCAGGTTGTCCAC No data
Right 1087956159 11:104290123-104290145 TCCACAGGATTTATTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087956157 Original CRISPR GTGGACAACCTGAATGAGCT TGG (reversed) Intergenic
No off target data available for this crispr