ID: 1087956858

View in Genome Browser
Species Human (GRCh38)
Location 11:104299239-104299261
Sequence CAGTCTCAGCAAAGGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087956858_1087956863 12 Left 1087956858 11:104299239-104299261 CCTGTGTTCCTTTGCTGAGACTG No data
Right 1087956863 11:104299274-104299296 TTCATCCATGTCCCTGCAAAGGG 0: 139
1: 247
2: 256
3: 535
4: 1011
1087956858_1087956862 11 Left 1087956858 11:104299239-104299261 CCTGTGTTCCTTTGCTGAGACTG No data
Right 1087956862 11:104299273-104299295 CTTCATCCATGTCCCTGCAAAGG 0: 5722
1: 13953
2: 17651
3: 7003
4: 4429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087956858 Original CRISPR CAGTCTCAGCAAAGGAACAC AGG (reversed) Intergenic
No off target data available for this crispr