ID: 1087956860

View in Genome Browser
Species Human (GRCh38)
Location 11:104299247-104299269
Sequence GAATCCATCAGTCTCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087956860_1087956862 3 Left 1087956860 11:104299247-104299269 CCTTTGCTGAGACTGATGGATTC No data
Right 1087956862 11:104299273-104299295 CTTCATCCATGTCCCTGCAAAGG 0: 5722
1: 13953
2: 17651
3: 7003
4: 4429
1087956860_1087956863 4 Left 1087956860 11:104299247-104299269 CCTTTGCTGAGACTGATGGATTC No data
Right 1087956863 11:104299274-104299296 TTCATCCATGTCCCTGCAAAGGG 0: 139
1: 247
2: 256
3: 535
4: 1011
1087956860_1087956867 27 Left 1087956860 11:104299247-104299269 CCTTTGCTGAGACTGATGGATTC No data
Right 1087956867 11:104299297-104299319 CATGAACTCATCCTTTTTTATGG 0: 6520
1: 16826
2: 7677
3: 5376
4: 6414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087956860 Original CRISPR GAATCCATCAGTCTCAGCAA AGG (reversed) Intergenic
No off target data available for this crispr