ID: 1087956862

View in Genome Browser
Species Human (GRCh38)
Location 11:104299273-104299295
Sequence CTTCATCCATGTCCCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48758
Summary {0: 5722, 1: 13953, 2: 17651, 3: 7003, 4: 4429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087956860_1087956862 3 Left 1087956860 11:104299247-104299269 CCTTTGCTGAGACTGATGGATTC No data
Right 1087956862 11:104299273-104299295 CTTCATCCATGTCCCTGCAAAGG 0: 5722
1: 13953
2: 17651
3: 7003
4: 4429
1087956858_1087956862 11 Left 1087956858 11:104299239-104299261 CCTGTGTTCCTTTGCTGAGACTG No data
Right 1087956862 11:104299273-104299295 CTTCATCCATGTCCCTGCAAAGG 0: 5722
1: 13953
2: 17651
3: 7003
4: 4429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087956862 Original CRISPR CTTCATCCATGTCCCTGCAA AGG Intergenic
Too many off-targets to display for this crispr