ID: 1087956863 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:104299274-104299296 |
| Sequence | TTCATCCATGTCCCTGCAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2188 | |||
| Summary | {0: 139, 1: 247, 2: 256, 3: 535, 4: 1011} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087956860_1087956863 | 4 | Left | 1087956860 | 11:104299247-104299269 | CCTTTGCTGAGACTGATGGATTC | No data | ||
| Right | 1087956863 | 11:104299274-104299296 | TTCATCCATGTCCCTGCAAAGGG | 0: 139 1: 247 2: 256 3: 535 4: 1011 |
||||
| 1087956858_1087956863 | 12 | Left | 1087956858 | 11:104299239-104299261 | CCTGTGTTCCTTTGCTGAGACTG | No data | ||
| Right | 1087956863 | 11:104299274-104299296 | TTCATCCATGTCCCTGCAAAGGG | 0: 139 1: 247 2: 256 3: 535 4: 1011 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087956863 | Original CRISPR | TTCATCCATGTCCCTGCAAA GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||