ID: 1087956863

View in Genome Browser
Species Human (GRCh38)
Location 11:104299274-104299296
Sequence TTCATCCATGTCCCTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2188
Summary {0: 139, 1: 247, 2: 256, 3: 535, 4: 1011}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087956860_1087956863 4 Left 1087956860 11:104299247-104299269 CCTTTGCTGAGACTGATGGATTC No data
Right 1087956863 11:104299274-104299296 TTCATCCATGTCCCTGCAAAGGG 0: 139
1: 247
2: 256
3: 535
4: 1011
1087956858_1087956863 12 Left 1087956858 11:104299239-104299261 CCTGTGTTCCTTTGCTGAGACTG No data
Right 1087956863 11:104299274-104299296 TTCATCCATGTCCCTGCAAAGGG 0: 139
1: 247
2: 256
3: 535
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087956863 Original CRISPR TTCATCCATGTCCCTGCAAA GGG Intergenic
Too many off-targets to display for this crispr