ID: 1087967515

View in Genome Browser
Species Human (GRCh38)
Location 11:104436085-104436107
Sequence CCAACACTGAATACCGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087967507_1087967515 25 Left 1087967507 11:104436037-104436059 CCGTGATTGAAGGCACTATAAAT No data
Right 1087967515 11:104436085-104436107 CCAACACTGAATACCGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087967515 Original CRISPR CCAACACTGAATACCGGAGT GGG Intergenic
No off target data available for this crispr