ID: 1087970673

View in Genome Browser
Species Human (GRCh38)
Location 11:104478016-104478038
Sequence CACTGCCAGAATCAACTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087970671_1087970673 -2 Left 1087970671 11:104477995-104478017 CCACTATCCATTTTGTAAAAGCA No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data
1087970670_1087970673 -1 Left 1087970670 11:104477994-104478016 CCCACTATCCATTTTGTAAAAGC No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data
1087970672_1087970673 -9 Left 1087970672 11:104478002-104478024 CCATTTTGTAAAAGCACTGCCAG No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data
1087970669_1087970673 0 Left 1087970669 11:104477993-104478015 CCCCACTATCCATTTTGTAAAAG No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data
1087970668_1087970673 9 Left 1087970668 11:104477984-104478006 CCATCATCTCCCCACTATCCATT No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data
1087970667_1087970673 17 Left 1087970667 11:104477976-104477998 CCACGCTACCATCATCTCCCCAC No data
Right 1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087970673 Original CRISPR CACTGCCAGAATCAACTATT TGG Intergenic
No off target data available for this crispr