ID: 1087976656

View in Genome Browser
Species Human (GRCh38)
Location 11:104557516-104557538
Sequence GTCACAGGCCACCTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087976648_1087976656 -3 Left 1087976648 11:104557496-104557518 CCAAGAGAGGCCCTCCTGAAGTC No data
Right 1087976656 11:104557516-104557538 GTCACAGGCCACCTTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087976656 Original CRISPR GTCACAGGCCACCTTGGGGT TGG Intergenic
No off target data available for this crispr