ID: 1087982706

View in Genome Browser
Species Human (GRCh38)
Location 11:104635931-104635953
Sequence CCATGTGATCAGAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087982706_1087982710 5 Left 1087982706 11:104635931-104635953 CCATCTTTCCTCTGATCACATGG No data
Right 1087982710 11:104635959-104635981 TTTCTGACATGGCCAAACATTGG No data
1087982706_1087982711 8 Left 1087982706 11:104635931-104635953 CCATCTTTCCTCTGATCACATGG No data
Right 1087982711 11:104635962-104635984 CTGACATGGCCAAACATTGGTGG No data
1087982706_1087982709 -6 Left 1087982706 11:104635931-104635953 CCATCTTTCCTCTGATCACATGG No data
Right 1087982709 11:104635948-104635970 ACATGGATGCATTTCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087982706 Original CRISPR CCATGTGATCAGAGGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr