ID: 1087984115

View in Genome Browser
Species Human (GRCh38)
Location 11:104656474-104656496
Sequence GGATGGAATAATACAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087984112_1087984115 -6 Left 1087984112 11:104656457-104656479 CCAGATTAAAAATCCTTGGATGG No data
Right 1087984115 11:104656474-104656496 GGATGGAATAATACAAATTGAGG No data
1087984110_1087984115 10 Left 1087984110 11:104656441-104656463 CCTGAGAGTTTTCAAGCCAGATT No data
Right 1087984115 11:104656474-104656496 GGATGGAATAATACAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087984115 Original CRISPR GGATGGAATAATACAAATTG AGG Intergenic
No off target data available for this crispr