ID: 1087985054

View in Genome Browser
Species Human (GRCh38)
Location 11:104668458-104668480
Sequence ACGTTGGTACAGAGGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087985047_1087985054 12 Left 1087985047 11:104668423-104668445 CCTCCTCATACTGACTCTTCTCT No data
Right 1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG No data
1087985048_1087985054 9 Left 1087985048 11:104668426-104668448 CCTCATACTGACTCTTCTCTCAG No data
Right 1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG No data
1087985046_1087985054 20 Left 1087985046 11:104668415-104668437 CCTTTACTCCTCCTCATACTGAC No data
Right 1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG No data
1087985045_1087985054 21 Left 1087985045 11:104668414-104668436 CCCTTTACTCCTCCTCATACTGA No data
Right 1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087985054 Original CRISPR ACGTTGGTACAGAGGAAAGG AGG Intergenic
No off target data available for this crispr