ID: 1087993488

View in Genome Browser
Species Human (GRCh38)
Location 11:104774975-104774997
Sequence TGGGATCTTAACAGAGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087993484_1087993488 11 Left 1087993484 11:104774941-104774963 CCATAAAAACTCTCAAAGCAAGA No data
Right 1087993488 11:104774975-104774997 TGGGATCTTAACAGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087993488 Original CRISPR TGGGATCTTAACAGAGCTGA AGG Intergenic
No off target data available for this crispr