ID: 1087996345

View in Genome Browser
Species Human (GRCh38)
Location 11:104814009-104814031
Sequence TATGATAAGTAGTTGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087996343_1087996345 -2 Left 1087996343 11:104813988-104814010 CCCAAGATGGTGGCAGAGAATTA No data
Right 1087996345 11:104814009-104814031 TATGATAAGTAGTTGTATTCTGG No data
1087996344_1087996345 -3 Left 1087996344 11:104813989-104814011 CCAAGATGGTGGCAGAGAATTAT No data
Right 1087996345 11:104814009-104814031 TATGATAAGTAGTTGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087996345 Original CRISPR TATGATAAGTAGTTGTATTC TGG Intergenic
No off target data available for this crispr