ID: 1087996345 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:104814009-104814031 |
Sequence | TATGATAAGTAGTTGTATTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087996343_1087996345 | -2 | Left | 1087996343 | 11:104813988-104814010 | CCCAAGATGGTGGCAGAGAATTA | No data | ||
Right | 1087996345 | 11:104814009-104814031 | TATGATAAGTAGTTGTATTCTGG | No data | ||||
1087996344_1087996345 | -3 | Left | 1087996344 | 11:104813989-104814011 | CCAAGATGGTGGCAGAGAATTAT | No data | ||
Right | 1087996345 | 11:104814009-104814031 | TATGATAAGTAGTTGTATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087996345 | Original CRISPR | TATGATAAGTAGTTGTATTC TGG | Intergenic | ||
No off target data available for this crispr |