ID: 1088001541

View in Genome Browser
Species Human (GRCh38)
Location 11:104887750-104887772
Sequence CTCCTATAATTTAGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088001539_1088001541 -1 Left 1088001539 11:104887728-104887750 CCATTTCAAGATGACCAAGTTGC No data
Right 1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088001541 Original CRISPR CTCCTATAATTTAGAAAAAA AGG Intergenic
No off target data available for this crispr