ID: 1088002501

View in Genome Browser
Species Human (GRCh38)
Location 11:104899337-104899359
Sequence CAGGTGTTCAAGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088002501_1088002504 -10 Left 1088002501 11:104899337-104899359 CCCTTCTTCCTCTTGAACACCTG No data
Right 1088002504 11:104899350-104899372 TGAACACCTGAAGCTAAATGAGG No data
1088002501_1088002507 1 Left 1088002501 11:104899337-104899359 CCCTTCTTCCTCTTGAACACCTG No data
Right 1088002507 11:104899361-104899383 AGCTAAATGAGGATAAGCCTGGG No data
1088002501_1088002506 0 Left 1088002501 11:104899337-104899359 CCCTTCTTCCTCTTGAACACCTG No data
Right 1088002506 11:104899360-104899382 AAGCTAAATGAGGATAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088002501 Original CRISPR CAGGTGTTCAAGAGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr