ID: 1088011157

View in Genome Browser
Species Human (GRCh38)
Location 11:105002420-105002442
Sequence AAGAAAAAGGAGAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5371
Summary {0: 1, 1: 4, 2: 80, 3: 714, 4: 4572}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088011157_1088011165 9 Left 1088011157 11:105002420-105002442 CCCCCTTCCTTCTCCTTTTTCTT 0: 1
1: 4
2: 80
3: 714
4: 4572
Right 1088011165 11:105002452-105002474 CTCAAACATTTCTTATATTTAGG 0: 1
1: 1
2: 5
3: 56
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088011157 Original CRISPR AAGAAAAAGGAGAAGGAAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr