ID: 1088013396

View in Genome Browser
Species Human (GRCh38)
Location 11:105031055-105031077
Sequence TTCTCCAGAACTGCTCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088013395_1088013396 5 Left 1088013395 11:105031027-105031049 CCTTTATGTAAGGGGAGCAGAAG 0: 1
1: 1
2: 2
3: 11
4: 123
Right 1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG 0: 1
1: 0
2: 2
3: 18
4: 162
1088013391_1088013396 29 Left 1088013391 11:105031003-105031025 CCTGGGATTCTAGGATATAGAAA 0: 1
1: 1
2: 1
3: 13
4: 203
Right 1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG 0: 1
1: 0
2: 2
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088013396 Original CRISPR TTCTCCAGAACTGCTCAATG AGG Intronic
900215791 1:1480860-1480882 TTCTCAGCAACTTCTCAATGAGG + Exonic
900222928 1:1518914-1518936 TTCTCAGCAACTTCTCAATGAGG + Exonic
904297673 1:29532044-29532066 TTCTCTAGAACTGCGCTGTGTGG - Intergenic
905309898 1:37042167-37042189 TTCTGCAGACCCGCTCCATGTGG - Intergenic
905779967 1:40700042-40700064 TACACCAGAACTGCTCAACTGGG - Intronic
908588926 1:65607449-65607471 TCCTCCAGAACTGCTCAGGTTGG - Intronic
910572401 1:88720520-88720542 CTAGCCAGAACTTCTCAATGGGG - Intronic
912159088 1:106959228-106959250 TTTTCTAGTACTTCTCAATGAGG - Intergenic
915938037 1:160100200-160100222 TTCTCCAGGGTTCCTCAATGTGG - Intergenic
918072344 1:181142198-181142220 TTCTCCAGGACTCCTCGAAGGGG + Intergenic
920371460 1:205481798-205481820 CCCTCCAGCACTGCTCACTGTGG - Intergenic
921050750 1:211509572-211509594 TCCTCCAGACCTGCCCAATGCGG + Intergenic
921813555 1:219541836-219541858 ATTTCCAGAGCTGCACAATGTGG + Intergenic
921993253 1:221390141-221390163 TGGTCCACAACTGCTAAATGTGG - Intergenic
924563269 1:245174798-245174820 TTCTCCAGAAAAGCCCTATGGGG - Intronic
924583225 1:245339900-245339922 TTCTCCAACACGGCCCAATGGGG - Intronic
1064917312 10:20474321-20474343 GGCTCCAGAACTGCTGAAGGAGG + Intergenic
1065599713 10:27356398-27356420 ACCTCCAGAACCTCTCAATGAGG + Intergenic
1066582924 10:36900079-36900101 ACCTCCAGAACCTCTCAATGAGG - Intergenic
1066957451 10:42186468-42186490 TTCTTCAGAGTTGCTCCATGAGG - Intergenic
1068242883 10:54327683-54327705 TTCTTCAGAACAGCTAATTGAGG + Intronic
1071313811 10:84371633-84371655 TTCTCCAGAACTGCTTCTGGTGG - Exonic
1071918605 10:90324826-90324848 TTCTCAAAAATTGCTCCATGTGG + Intergenic
1074329394 10:112489458-112489480 ATTTCCAGAACTGCTCTTTGGGG + Intronic
1074472132 10:113736965-113736987 TTTTCCAGACTTGCTCAATTTGG - Intergenic
1075618529 10:123908682-123908704 TTCTCCAGAACAGCTGGAGGTGG + Intronic
1075725694 10:124609827-124609849 TACTCCACAACGGCTCAATCTGG - Intronic
1076085558 10:127627066-127627088 ATCTTCAGATCTGCTGAATGAGG - Intergenic
1078529907 11:12129383-12129405 GTCTCCTGACCTGTTCAATGGGG - Intronic
1079367967 11:19825973-19825995 TGCTCCAGAACTGCTCTGTGAGG - Intronic
1080338870 11:31233123-31233145 ATCTTCACAACAGCTCAATGAGG + Intronic
1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG + Intronic
1088261016 11:107944123-107944145 TTATCCAGGACTGCTCATTCTGG - Intronic
1088951914 11:114580264-114580286 TTCTCCAGACATGCCCACTGGGG + Exonic
1091101861 11:132881865-132881887 TTCTCCAGATCTGGGAAATGTGG + Intronic
1091468213 12:704172-704194 TTCTCCAGAGGCGCTGAATGGGG - Intergenic
1094024320 12:25946414-25946436 TTCTCCAGGAATGCCCCATGGGG + Intergenic
1101199547 12:102420299-102420321 TTCTCCTGGGCTCCTCAATGAGG - Intronic
1101982842 12:109422468-109422490 TTCTCCACAGCTACTCCATGAGG - Intronic
1103557211 12:121773903-121773925 TTCCCCTGAAATTCTCAATGAGG - Intronic
1105445059 13:20446552-20446574 TTCTCCCATTCTGCTCAATGGGG - Intronic
1106203374 13:27564527-27564549 TTCTTCAAAACTGCTCAAAGAGG + Intronic
1111730442 13:92069749-92069771 TTATCCAGAACTGCCAAATCTGG + Intronic
1112105164 13:96232062-96232084 TTTTCCAGATCTGGTCAATGCGG - Intronic
1112224905 13:97530089-97530111 TTTTACAGGACTGCTCACTGCGG + Intergenic
1113770028 13:112902259-112902281 TTCCCCACAACGGCCCAATGAGG + Intronic
1115976334 14:39001104-39001126 TTCTCCACAACAACCCAATGGGG + Intergenic
1118083730 14:62392212-62392234 TTCTACAGAAATGCTTAAGGGGG - Intergenic
1121999745 14:98637102-98637124 AGTCCCAGAACTGCTCAATGTGG + Intergenic
1124993161 15:34695800-34695822 CTCTCCTGAACTACTCACTGTGG - Intergenic
1125536604 15:40444241-40444263 TTCTCCAGAAATGCTCATATTGG + Intronic
1129653678 15:77508727-77508749 TTCTCCAAAACTTCTCATTTGGG - Intergenic
1133599378 16:7324308-7324330 GTCTCCAGGACTGGTAAATGAGG - Intronic
1133736328 16:8618787-8618809 TCCTCCAGGACTGCTGAAAGTGG - Intergenic
1144336842 17:14279032-14279054 TTCTCCAGAATTACTCAATGGGG + Intergenic
1145056176 17:19705489-19705511 TTCTCTAGGGCTGCTCAGTGTGG - Exonic
1146572637 17:33966107-33966129 TTCTACAGAATTGTTCATTGTGG - Intronic
1147768877 17:42854435-42854457 TTCTCCAGTCCTGCTCAGGGTGG - Exonic
1147771680 17:42872392-42872414 TTCTCCAGTCCTGCTCAGGGTGG - Intergenic
1148517135 17:48230374-48230396 TCTTCCAGAACTGCTTGATGGGG + Intronic
1150802549 17:68292904-68292926 TTCTCCAGATCTGTAAAATGGGG + Intronic
1152983911 18:305014-305036 TTCTCCTGAGCTGCTCTGTGGGG + Intergenic
1152996788 18:414833-414855 TTCTCTAGAACTGCTGATTAAGG + Intronic
1156477262 18:37413605-37413627 TTTTCCATAACTGGTCCATGGGG - Intronic
1159827175 18:73228129-73228151 TTCTCCAGAAATCCTCATTTAGG + Intronic
1163782181 19:19256413-19256435 TTCTCAGGAACTTCTCATTGTGG - Exonic
1167204265 19:48089715-48089737 TTCTCCTGCACTGCTCACTCTGG - Intronic
925448519 2:3949041-3949063 TTCCCCAGATCTGCTGAATCAGG + Intergenic
925807102 2:7661246-7661268 TTCTCCACAGCTGCTCAAGTGGG - Intergenic
926905806 2:17804625-17804647 TTCTGCATAACTGCCCATTGTGG + Intergenic
928148981 2:28809723-28809745 TTCTTCAGAACTGCTGATTGAGG + Intronic
929200076 2:39225912-39225934 TTCTCCTGAACACCTCGATGAGG + Exonic
929393022 2:41493833-41493855 TTCTCCAGGACTCCTCTCTGTGG + Intergenic
930002956 2:46873598-46873620 TTCACCAGATCTGTGCAATGGGG - Intergenic
932738258 2:74271081-74271103 CATTCCAGACCTGCTCAATGAGG - Intronic
933854184 2:86397325-86397347 CTCTCCAGGTCTGCTAAATGGGG + Intergenic
937101754 2:119276609-119276631 TTTTCCTGAAGTGCTCAATTTGG - Intergenic
939656709 2:144835293-144835315 TTCTTCAGAACTGTGAAATGAGG - Intergenic
941351739 2:164446215-164446237 TTCTCCAGCTCTCTTCAATGTGG + Intergenic
942106352 2:172637211-172637233 TGCTCCAGAACAGGTCAAAGTGG - Intergenic
943948121 2:194093366-194093388 TTCTCCAGGAATGCACCATGAGG - Intergenic
944473495 2:200080609-200080631 TTTTCCTCAACTGCACAATGAGG + Intergenic
945961262 2:216137340-216137362 TGCCCCAGAACTACACAATGAGG - Intronic
945986089 2:216354743-216354765 TTCACCAGTCTTGCTCAATGAGG - Intronic
946307664 2:218865350-218865372 TTCTCCAGAACTGCCGGAGGAGG + Intronic
947274719 2:228377477-228377499 TTCTCCAGCACTGAGAAATGGGG - Intergenic
948236146 2:236392282-236392304 TGATCCAGAACTGATCAAAGAGG - Exonic
948503117 2:238409114-238409136 CTCTCCTGAACTGCTCCCTGGGG - Intergenic
1169961598 20:11166259-11166281 TTCACCAGTGCTTCTCAATGTGG + Intergenic
1170031587 20:11949577-11949599 TTTACCAGAATTCCTCAATGGGG - Intergenic
1173402129 20:42735029-42735051 TGTTCCAGAAGTGCTCAATAAGG + Intronic
1173633467 20:44533934-44533956 TTCACCAAATCTGCTCAATGAGG - Intronic
1173890814 20:46508584-46508606 TTCTTCAGAGGGGCTCAATGTGG + Intronic
1177377113 21:20285472-20285494 TTCTCCACAAATTCTCATTGTGG + Intergenic
1179059067 21:37963012-37963034 TTCTAAAGAATTGCTCAAAGTGG - Intronic
1179805510 21:43834686-43834708 TTCACCAAAGCTGCTCATTGAGG - Intergenic
949244229 3:1906528-1906550 TACTACAGCACTGCTCACTGAGG - Intergenic
956851775 3:73234749-73234771 TTCACCAGGACTGCTCTTTGTGG + Intergenic
958565797 3:95808149-95808171 GACACCAGAACTGATCAATGAGG - Intergenic
959856588 3:111165937-111165959 TTTTCCTGAGCTGCTAAATGTGG + Intronic
960977125 3:123186216-123186238 TTGACCATCACTGCTCAATGGGG + Intronic
961512449 3:127411340-127411362 TTCCTCAGAGCTGCTCAGTGTGG - Intergenic
963914646 3:150847101-150847123 TTCTCCAGGAATGCCCCATGAGG + Intergenic
967785684 3:193491818-193491840 TTTTCCAGAACTTCTAAATAGGG - Intronic
968428597 4:539270-539292 TTCTCCAAAACTTCTCTACGAGG + Exonic
970069980 4:12147321-12147343 ATCTCCAGAACATCTCAATTTGG + Intergenic
971172034 4:24243138-24243160 TTCACCAGAACTGCTCATGAAGG + Intergenic
971186389 4:24381246-24381268 TGCTCCAGCAATGGTCAATGAGG - Intergenic
975169534 4:71216932-71216954 TTCTCCACAACTGAACAATGTGG + Intronic
976732828 4:88281837-88281859 TCCTCCAGAACTCCACAATTGGG + Intronic
977728949 4:100329265-100329287 TTCTCCAGATCTTCTCAAAGTGG + Intergenic
978050016 4:104187044-104187066 TGCTCCTTCACTGCTCAATGAGG + Intergenic
978103879 4:104877209-104877231 TTCTCCACATGTACTCAATGAGG + Intergenic
978232188 4:106413060-106413082 TTCTCAGGATCTGGTCAATGAGG - Intergenic
978322923 4:107517803-107517825 AGCTCTAGAAATGCTCAATGAGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
983653947 4:170061891-170061913 TTCTCCAGAACAGATGGATGTGG - Exonic
983869210 4:172805349-172805371 TTCTACAAAACTGCTAAATTTGG + Intronic
984426746 4:179597315-179597337 TTGTCCTGAACTGCCCACTGAGG + Intergenic
984925429 4:184802439-184802461 TTCTGCATATCTGCTGAATGCGG + Intronic
985770088 5:1804165-1804187 TGCTCCAGAACTGCTCAATCTGG - Intronic
986009440 5:3698965-3698987 TTCTCCAGAACGGTGCACTGGGG - Intergenic
986823042 5:11489717-11489739 TTCTCCATACTTGCTCACTGAGG + Intronic
989209088 5:38842337-38842359 TTCTACAGAACTTGTCGATGAGG + Intergenic
990646027 5:57845358-57845380 CTCTCCAGACCTGCTCATGGTGG - Intergenic
996548698 5:124707811-124707833 TTCTCCAGAACTAATCATTGAGG + Intronic
996571971 5:124941413-124941435 TTCTACAGAACTGCTTATTCTGG - Intergenic
997715954 5:136043000-136043022 TACCGCAGAACTGCTCACTGTGG - Intronic
1000107369 5:158072989-158073011 TTCTGCAGAACTGCTCTGTGTGG - Intergenic
1000240675 5:159405384-159405406 TTCTCCACAACTGCTCCGTAAGG - Intergenic
1005249188 6:23924918-23924940 TTTTCCAGAGCTGTTAAATGGGG + Intergenic
1008686433 6:53930610-53930632 TTGTCCAGGGCTGCTCAGTGTGG + Intronic
1011357206 6:86484089-86484111 ATCTCCAGGAATGCTCTATGAGG - Intergenic
1017920058 6:158863811-158863833 TTCTCCAAAGCTGCTCACTTTGG - Intergenic
1019089482 6:169516452-169516474 TCCTCCAGAACTCCTCCAGGGGG + Intronic
1021227927 7:18050575-18050597 TTCTCCATATCTGCTCCATGTGG - Intergenic
1021421516 7:20450139-20450161 CTCTCCAGACCTGCTGAATCAGG + Intergenic
1022234559 7:28448402-28448424 TTTTCTAGACCTGCTCAATGTGG + Intronic
1022493945 7:30841415-30841437 CTCTCCAGAAATGCTCCATGAGG + Intronic
1022713259 7:32873270-32873292 TTCTCCTTAATTGCTCAATATGG + Intronic
1026117362 7:67507199-67507221 TTCTCCAGCACTTCTCACTATGG - Intergenic
1026608774 7:71838702-71838724 ATCACCAGAACTGCAGAATGGGG - Intronic
1029834138 7:103291406-103291428 TTCTCCAGAATTCCTCTATTTGG - Intergenic
1032338735 7:131050616-131050638 TTCTTCACAACTTCTCACTGAGG + Intergenic
1033122917 7:138681970-138681992 TTCTCCAAAGGTGATCAATGAGG - Intronic
1034476111 7:151283309-151283331 TTTTCCTGCATTGCTCAATGTGG - Intergenic
1034478098 7:151300362-151300384 TTCTCCAGACCTGCCCCAAGGGG + Intergenic
1035891975 8:3355586-3355608 TTCCACAGAACTGCACGATGTGG + Intronic
1036053787 8:5228331-5228353 TTGCCCAGAAATGCTCAGTGGGG - Intergenic
1036891172 8:12598179-12598201 TTTTCTAGGACTTCTCAATGGGG + Intergenic
1038029443 8:23624323-23624345 TACCCCAGAACTGCTGAATCAGG - Intergenic
1039059444 8:33561947-33561969 TTCTCCAATACTACTCCATGTGG + Intronic
1039404949 8:37304478-37304500 TTCCCCAGACTTGCTCAGTGAGG + Intergenic
1042925768 8:73967032-73967054 TTCTTCAGAACAGCTCTGTGAGG - Intronic
1043232235 8:77817633-77817655 TTCTCCAGTTCTCCTCAAAGAGG + Intergenic
1044297851 8:90549082-90549104 TTCTCCAGCACTTCAGAATGTGG + Intergenic
1044803830 8:95984292-95984314 TTCCCCAGAACTGGAGAATGAGG + Intergenic
1046253981 8:111672474-111672496 TTCTCCAGGAATGCCCCATGAGG - Intergenic
1050668599 9:7969813-7969835 TTGACCAGCACTTCTCAATGGGG + Intergenic
1051101907 9:13531531-13531553 TTTTCCAGCACTGATCAGTGAGG + Intergenic
1051905325 9:22088363-22088385 TTTTCCAGAAATTCTCAATGGGG - Intergenic
1054923463 9:70564794-70564816 ATCTACAGAAATGATCAATGTGG + Intronic
1057329212 9:94096911-94096933 TTCTCAAGAACTGTTCAGAGTGG + Intronic
1058734019 9:107877620-107877642 TGCTCCAGAAATACACAATGGGG + Intergenic
1059391612 9:114002739-114002761 TCCCCCAGAACTGCTCCAGGTGG + Intronic
1059409464 9:114123121-114123143 TTCTCCAGGACTCAACAATGGGG + Intergenic
1061007632 9:127937296-127937318 CTCTCCAGAACAACTCTATGAGG - Intronic
1061744634 9:132730601-132730623 TTGCCCAGAACTGCTCAGTCAGG + Intronic
1061807734 9:133145758-133145780 GTCTCCTGACCTGCACAATGGGG + Intronic
1185992946 X:4912397-4912419 TTCTCCAGAACAGCAGCATGGGG - Intergenic
1189371597 X:40433544-40433566 TCCTCCAGAAGTGCTCAAGTGGG - Intergenic
1190039555 X:47058828-47058850 TACCCCAGAACTGCTCCTTGGGG - Exonic
1195714816 X:107808512-107808534 ATCTCCAGGACAGCTCAATGAGG - Intergenic
1196682013 X:118479059-118479081 ATCTCCAGAATTGTTCAATGTGG + Intergenic
1196694223 X:118594013-118594035 TTTTCCAGTTCTGCTCACTGAGG + Intronic
1196856288 X:119988506-119988528 ATCTCCACAACAGCTCCATGAGG + Intergenic
1196858226 X:120003144-120003166 ATCTCCACAACTGCTCCATGAGG - Intergenic
1196860042 X:120018008-120018030 ATCTCCACAACAGCTCCATGAGG - Intergenic
1197677761 X:129348182-129348204 TTCTCCAGAATTGGTCCCTGTGG - Intergenic
1199076069 X:143528742-143528764 TTCTCCAGAATTGGTCCATGTGG + Intergenic
1199268276 X:145852764-145852786 TGCTTCAGAACTTATCAATGTGG + Intergenic
1201463200 Y:14251152-14251174 GTCTCCAGAAATGCTAAATAAGG + Intergenic
1201493516 Y:14568299-14568321 TTCTCCTGAAGGGCTCACTGTGG - Intronic