ID: 1088025787

View in Genome Browser
Species Human (GRCh38)
Location 11:105180768-105180790
Sequence TCAGGATTGTCGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088025782_1088025787 3 Left 1088025782 11:105180742-105180764 CCAATTGCTAGAGTGAGAATTAG No data
Right 1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG No data
1088025781_1088025787 6 Left 1088025781 11:105180739-105180761 CCACCAATTGCTAGAGTGAGAAT No data
Right 1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088025787 Original CRISPR TCAGGATTGTCGGCCGGGCG CGG Intergenic
No off target data available for this crispr