ID: 1088032726

View in Genome Browser
Species Human (GRCh38)
Location 11:105271008-105271030
Sequence CAGAAAAATTAGATGACGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088032726_1088032730 25 Left 1088032726 11:105271008-105271030 CCCAACGTCATCTAATTTTTCTG No data
Right 1088032730 11:105271056-105271078 TAGTTTTGCATTTTACATTTAGG 0: 79
1: 214
2: 419
3: 747
4: 2015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088032726 Original CRISPR CAGAAAAATTAGATGACGTT GGG (reversed) Intergenic
No off target data available for this crispr