ID: 1088034460

View in Genome Browser
Species Human (GRCh38)
Location 11:105295349-105295371
Sequence CAATATTAGATCAATGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088034460_1088034464 15 Left 1088034460 11:105295349-105295371 CCTGTCTCATTGATCTAATATTG No data
Right 1088034464 11:105295387-105295409 AGTCTCCCACTATTATTGTGTGG 0: 1257
1: 5149
2: 5372
3: 1946
4: 1256
1088034460_1088034465 16 Left 1088034460 11:105295349-105295371 CCTGTCTCATTGATCTAATATTG No data
Right 1088034465 11:105295388-105295410 GTCTCCCACTATTATTGTGTGGG 0: 1186
1: 4987
2: 5079
3: 1872
4: 1067

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088034460 Original CRISPR CAATATTAGATCAATGAGAC AGG (reversed) Intergenic
No off target data available for this crispr