ID: 1088034796

View in Genome Browser
Species Human (GRCh38)
Location 11:105298413-105298435
Sequence ATCTCTCTGCAGAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088034794_1088034796 -9 Left 1088034794 11:105298399-105298421 CCAGGCCTCAGCATATCTCTCTG No data
Right 1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088034796 Original CRISPR ATCTCTCTGCAGAAGATGAC AGG Intergenic
No off target data available for this crispr