ID: 1088037417

View in Genome Browser
Species Human (GRCh38)
Location 11:105334359-105334381
Sequence CCTGGCCAGACTGTTTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088037409_1088037417 21 Left 1088037409 11:105334315-105334337 CCAGGAGGAACTCCCCACAGTGC No data
Right 1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG No data
1088037412_1088037417 8 Left 1088037412 11:105334328-105334350 CCCACAGTGCAGCACCGTGGCTA No data
Right 1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG No data
1088037411_1088037417 9 Left 1088037411 11:105334327-105334349 CCCCACAGTGCAGCACCGTGGCT No data
Right 1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG No data
1088037413_1088037417 7 Left 1088037413 11:105334329-105334351 CCACAGTGCAGCACCGTGGCTAT No data
Right 1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG No data
1088037415_1088037417 -6 Left 1088037415 11:105334342-105334364 CCGTGGCTATGACAGATCCTGGC No data
Right 1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088037417 Original CRISPR CCTGGCCAGACTGTTTCCTT AGG Intergenic
No off target data available for this crispr