ID: 1088039861

View in Genome Browser
Species Human (GRCh38)
Location 11:105366867-105366889
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088039861_1088039863 -5 Left 1088039861 11:105366867-105366889 CCCTCTTCTTACAGCTTCTACTT No data
Right 1088039863 11:105366885-105366907 TACTTCCAATTCAGTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088039861 Original CRISPR AAGTAGAAGCTGTAAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr