ID: 1088047985

View in Genome Browser
Species Human (GRCh38)
Location 11:105476851-105476873
Sequence ACAGAGGAGCAGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088047985_1088047990 -1 Left 1088047985 11:105476851-105476873 CCTTCCTCATCCTGCTCCTCTGT No data
Right 1088047990 11:105476873-105476895 TAAAATGGCATCTGACTGTGTGG No data
1088047985_1088047992 28 Left 1088047985 11:105476851-105476873 CCTTCCTCATCCTGCTCCTCTGT No data
Right 1088047992 11:105476902-105476924 AAGCAATGTTTAAATGACTTTGG No data
1088047985_1088047991 5 Left 1088047985 11:105476851-105476873 CCTTCCTCATCCTGCTCCTCTGT No data
Right 1088047991 11:105476879-105476901 GGCATCTGACTGTGTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088047985 Original CRISPR ACAGAGGAGCAGGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr