ID: 1088057840

View in Genome Browser
Species Human (GRCh38)
Location 11:105607166-105607188
Sequence AATGAACGGTTATAAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088057840_1088057844 24 Left 1088057840 11:105607166-105607188 CCCCTTGCTTATAACCGTTCATT No data
Right 1088057844 11:105607213-105607235 GACAATGCTTCTGAGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088057840 Original CRISPR AATGAACGGTTATAAGCAAG GGG (reversed) Intergenic
No off target data available for this crispr